1. A sample DNA was analyzed. 42% of the nucleotides contained Adenine. Calculate the % of nucleotide that contains Guanine. How many % are Thymine and Cytosine?
Q: A. Mechanical stimulation (pinching free end of nerves between two glass rods) B. Threshold stimulus…
A: In frog, the sciatic nerve is a collection of nerve fibers present in a single bundle. These fibers…
Q: Which of the following instrument is used to listen to the internal sounds of the human body? a)…
A: Introduction - We can easily hear air moving through the mouth and nose, as well as in and out of…
Q: Please explain the difference between bacteraemia and septicaemia. Can the presence of toxins, fungi…
A: Blood poisoning caused by bacteria is known as septicemia, or sepsis. It's the body's most ferocious…
Q: Question 20 Membranes with unsaturated fatty acids in their components are more flexible and fluid…
A: Membrane contain lipids which contains the unsaturated fatty acid . And the unsaturated fatty acids…
Q: Q.2. State the behavioural changes observed in an alcohol addict and remedial measures to overcome…
A: The following modifications have been observed: Because alcoholic beverages are expensive, they…
Q: Question 8 Which of the following is the correct order of mechanism of how sugar is perceived? 1.…
A: The tongue is present at the floor of the mouth. The sensory receptors are present within the taste…
Q: KARYOTYPE #9 (IIEMI ID L MIE I DA ED
A:
Q: What are the cofactors are involved in redox reactions? selected all that apply: A) FAD B) CoA…
A: Coenzyme are tiny organic non - protein molecules that are needed by enzyme and thus promote its…
Q: Proteins such as Dicer and RDE-R are involved in RNAi inactivation of target gene expression and are…
A: RNA is a molecule that plays a central role in the process of protein synthesis. RNA is made up of…
Q: A wealthy elderly couple die together in an accident. Soon, a man shows up to claim their fortune,…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Which of the following explains why prokaryotes have a bigger gene-to-genome size ratio compared to…
A: *prokaryotic genome is composed of single or double stranded DNA molecule form of circle. The…
Q: A team of researchers investigated the effects of phosphorous availability and light intensity on an…
A: Plants produce food through the physicochemical process of photosynthesis, which is a…
Q: n your own words, Write a reflection, As a road user, how will the mandatory medical and Drug…
A: Safety is the major concern while driving. These days it has become common to use drugs in everyday…
Q: A child could have the same blood type as one of his/her parents but it doesn't always happen that…
A: Blood types are the result of the presence or absence of antigens on the surface of the individuals…
Q: What is the shape of the bacteria in the pictures under microscope ( Cocci or Bacilli ) and why with…
A: Bacilli and cocci are different shaped bacteria and they named according to their shape . The…
Q: iscu
A: Answer- Human sexuality is the way people experience and express themselves sexually.Biological,…
Q: As a Dentistry student, what do you think is the importance of studying all the cranial nerves.
A: The cranial nerves are a group of 12 nerves that run along the back of your head. They also assist…
Q: Q.10. Define artificial selection. Has it affected the process of natural selection?
A: Introduction In this question we will discuss about the artificial selection.
Q: 6. Which of the following statements about biotic potential is TRUE? Biotic potential of an organism…
A: 6th answer is b is true Increase in food supply increases the biotic potential of an organism
Q: 1. What is an unusual feature of the nervous network of cnidarians?
A: Nervous network of cnidarians :-
Q: (b) How is ATP converted to ADP by glucose? Explain. Why is there intake of phosphoric acid by…
A: Cellular respiration is a metabolic process in which glucose is converted into carbon dioxide,…
Q: 1)In the regulation of heart rate, which of the following is the proper stimulus? Group of answer…
A: * Heart rate can be defined as number of times the heart beats in a certain time period or a…
Q: Place the following structurees of the internal kidney in the correct order in which urine passes…
A: Kidneys can be referred to as bean-shaped organs associated with filtering wastes present in blood…
Q: Diets aimed at reducing coronary heart disease should be: O low in trans-fatty acids and low in…
A: Coronary heart disease refers to the disease involving the coronary arteries ( arteries which supply…
Q: (d) Why are omega-3 fatty acids called essential fatty acids? Provide the structure of any such…
A: The fatty acids are simplest form of lipids that contain long hydrocarbon chain. They are classified…
Q: Question 15 A patient is brought to the hospital and has suffered extreme blood loss. The patients…
A: Donor for the blood transfusion :-
Q: how space constraints affect the brain development?
A: Introduction : The brain is made of three main parts: the forebrain, midbrain, and hindbrain. The…
Q: 2. Assume 250 base pairs to be responsible for a particular portion of mRNA molecule. What is the…
A: bp = base pair—one bp corresponds to approximately 3.4 Å of length along the strand 1angstrom (Å),…
Q: Disinfectant Concentration Growth after time of exposure (minutes) Control 5 minutes 10 minutes…
A: * Disinfectant is a chemical substance that inactivates or to destroy the microorganisms that are…
Q: Q.3. Why is it that women exceeding 40 years of age have more chances of having a child with Down's…
A: Introduction We will answer the question in below step.
Q: Which is a low calorie non-saccharide artificial sweetener?
A: Aspartame Aspartame (APM) is an artificial, non-saccharide, low-calorie sweetener used as a sugar…
Q: Question 12 Five sweetener samples (labelled A to E) were tested by 97 individuals for the intensity…
A: Humans have long been drawn to sweet foods. Since the dawn of time, humans have liked nutritive…
Q: Defining occupational health and safety and its importance in the work environment.
A: occupational health deals with all aspects of health and safety in the workplace and has a strong…
Q: 3. Listed within this chart are descriptions of a variety of DNA mutations. Your job is to fill in…
A: *Mutations cause change in DNA sequence thar are resulted from DNA copying errors during cell…
Q: . How is convergent evolution different from divergent evolution?
A: Introduction We will answer the question in below step.
Q: c. Out of two alleles, it is the one that is being suppressed by its alternative allele. d. It is…
A: Words that are being described here are terms related to genetics. Genetics is a branch of biology…
Q: ). (a) What is the role of the enzyme chymotrypsin? What type of substrate the enzyme works on?…
A: chymotrypsin is a proteolytic enzyme (serine protease) acting in the digestive systems of many…
Q: Question 32 Which of the following relationship is TRUE about carrageenans? O a. higher degree of…
A: Sulphated sugars derived from red seaweed are known as carrageenan. It's an anionic linear…
Q: 1. You are studying a biochemical pathway and isolate Neurospora mutants I, II, and III. Mutant I…
A: The biochemical pathway is the series of steps which are responsible for conversion of substrate…
Q: 20. Human placenta is derived from a) amnion b) chorion c) allantois and chorion d) allantois
A: Introduction The placenta is an organ that develops in the uterus during pregnancy. This structure…
Q: 1. List the major contributors to modern biology concepts in your own words, briefly describe their…
A: In biology there were a number of scientists that have made a remarking contribution in different…
Q: Draw the potential tautomers of guanine.
A: DNA- DNA acts as the genetic material in most of the organisms . DNA stands for the…
Q: QUESTION 24 A particular cell from a goldfish contains 50 chromosomes at the start of the cell…
A: Mitosis is a cycle where a single cell isolates into two identical daughter cells (cell division).…
Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…
A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…
Q: What is the purpose of the negative and positive control in the Disc diffusion assay? Why is it…
A: The disc diffusion assay is used to determine the susceptibility of test bacteria to different…
Q: State the function of histones in DNA packaging.
A: Introduction In this question we have to state the function of histones in DNA packaging.
Q: What are the similarities and differences between airborne and direct disease transmission? Discuss…
A: Airborne disease…
Q: uestion 18 Glycerophospholipids are the most abundant lipids in cellular membranes and are also…
A: Glycerophospholipids are the most abundant phospholipids. They are found in highest amounts in the…
Q: The erythrocyte sedimentation rate (heaviness) test of a blood sample is often used as a diagnosis…
A: Given data:- Diameter of RBC = D = 5 micrometer = 5×10-6 meter Density of RBC= 1.125 g/ml = 1125…
Q: Mention two effects that phosphorylation of the CTD tail of RNA polymerase II has on the…
A: The CTD is expanded as a C-terminal repeat domain. It is a type of unusual extension that has a…
Step by step
Solved in 2 steps
- Assume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule. What is the length of that mRNA in (1) angstrom? (2) in micrometers?Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)For each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)
- (a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- (a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5' - ATGTTACTAGT C-3' (b) The following section of DNA is used to build an MRNA for a protein: 3'-AAG-CTT-CTC-5'. What is the corresponding mRNA sequence?
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tableIf mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and visualized by electron microscopy, two types of structures are seen: RNA:DNA double-stranded heteroduplexes and single stranded DNA loop structures, as shown in the diagrams below. What do you think these single stranded DNA loops represent? (a) Micrograph of DNA-RNA hybrid (b) Interpretation of micrograph Single-stranded DNA only Single-stranded DNA base paired with MRNA Select one: а. Exons b. Introns c. 5' UTR d. 3' UTR e. promoterSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…