Place the steps of whole genome sequencing in order. 1234567910****11Apply genomic fragments to the flow cellIsolate many copies of your candidate mutant's entire genome.Assemble the genomic reads into full length chromosomes based on overlapping sequenceCompare the assembled sequence to the reference Saccharomyces cerevisiae genome to identify mismatches⠀ Fragment the genome into <500 bp segments8⠀ Capture the fluorescence emitted by each cluster - the wavelength indicates the identity of the first nucleotide in the fragmentAttach DNA "adapters" to each genomic fragment that are complementary to primers on the flow cellAdd complementary PCR primer, DNA polymerase, and fluorescently labelled blocked nucleotidesCreate millions of immobilized "clusters" of unique genomic fragments through bridge amplificationRepeat the previous steps between 150-300 additional times to determine the identity of each consecutive base in the genomic fragmentQuench the fluorescent signal of the first added dNTP and remove its reversible terminator.

Name: Place the steps of whole genome sequencing in order. 1234567910****11A
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Place the steps of whole genome sequencing in order. 1234567910****11Apply genomic fragments to the flow cellIsolate many copies of your candidate mutant's entire genome.Assemble the genomic reads into full length chromosomes based on overlapping seq

Sequencing refers to the process of determining the precise order of nucleotides (the building…

Science

Biology

1 2 3 4 5 6 7 8 9 10 11 Apply genomic fragments to the flow cell Isolate many copies of your candidate mutant's entire genome. Assemble the genomic reads into full length chromosomes based on overlapping sequence Compare the assembled sequence to the reference Saccharomyces cerevisiae genome to identify mismatches Fragment the genome into <500 bp segments Attach DNA "adapters" to each genomic fragment that are complementary to primers on the flow cell Add complementary PCR primer, DNA polymerase, and fluorescently labelled blocked nucleotides Capture the fluorescence emitted by each cluster - the wavelength indicates the identity of the first nucleotide in the fragment Create millions of immobilized "clusters" of unique genomic fragments through bridge amplification Repeat the previous steps between 150-300 additional times to determine the identity of each consecutive base in the genomic fragment Quench the fluorescent signal of the first added dNTP and remove its reversible terminator.

1 2 3 4 5 6 7 8 9 10 11 Apply genomic fragments to the flow cell Isolate many copies of your candidate mutant's entire genome. Assemble the genomic reads into full length chromosomes based on overlapping sequence Compare the assembled sequence to the reference Saccharomyces cerevisiae genome to identify mismatches Fragment the genome into <500 bp segments Attach DNA "adapters" to each genomic fragment that are complementary to primers on the flow cell Add complementary PCR primer, DNA polymerase, and fluorescently labelled blocked nucleotides Capture the fluorescence emitted by each cluster - the wavelength indicates the identity of the first nucleotide in the fragment Create millions of immobilized "clusters" of unique genomic fragments through bridge amplification Repeat the previous steps between 150-300 additional times to determine the identity of each consecutive base in the genomic fragment Quench the fluorescent signal of the first added dNTP and remove its reversible terminator.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 18P: Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA...

See similar textbooks

Similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
Give typing answer with explanation and conclusion 5'ATTAGGAGGTGCGTTATGCAGGCATGTTACGTACGTACG,TAAGATAAGTACT3’ 3' TAATCCTCCACGCAATACGTCCGTACAATGCATGCATGCATTCTATTCATGA5’ In the above piece of double stranded DNA, how many potential translations start sites exist if an mRNA could be synthesized from any portion of this DNA? Indicate where they are in the DNA above and explain how you found this number.
Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.
Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Multiple Replication Forks in E. coli I Assuming DNA replication proceeds at a rate of 750 base pairs per second, calculate how long it will take to replicate the entire E. coli genome. Under optimal conditions, E. coli cells divide every 20 minutes. What is the minimal number of replication forks per E. coli chromosome in order to sustain such a rate of cell division?
Functional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’