Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to eachmonosaccharide by a glycosidic bond.glycoprotein Aglycoprotein Bglycoprotein CHAHOНCH₂OHHOOH НHCH₂OHНОНHOHN-C-CH3оc=0NHI-NH-C - CH2C-HОННннОН ННCH2OHОнOH HOНNH1С=0-CH2-C-нNHC=0LO-CH2-C-HNHAВс

Cavalent or generally enzymatic reactions takr place after or during translation are termed as post…

Answered: Glycosylation is a major type of…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Match the post-translational protein modification to its function. Creates new binding sites by neutralizing positive charges Form protein complexes through quatenary structures Protein localization in the endomembrane system Targets proteins for degradation Creates new binding sites by adding negative charges Lipid anchors Glycosylation Alkylation Polymerization Phosphorylation Aceylation Ubiquitination…
Which of the choices are types of posttranslational modifications a newly synthesized protein may undergo? Select all the choices that apply. changes to hydrogen bonding capabilities formation of an amide bond between Cys and an isoprenyl group removal of prosthetic groups removal of the thiol group from a Cys residue modulation of charges on amino acids proteolytic cleavage covalent attachment of oligosaccharides to Asn, Thr, or Ser
Amino sequence: Gln-Glu-Val-Leu-Ile-Arg-Leu-Phe-Lys-Gly-His-Pro-Glu-Thr-Leu-Glu-Lys-Phe-Asp-Lys-Phe-Lys-His-Leu-Lys-Ser-Glu-Asp-Glu-Met-Lys-Ala-Ser-Glu-Asp-Leu-Lys A) List the fragments generated with trypsin: B) List the fragments generated with chymotrypsin (5 pts) (assume reaction conditions are used to maximize cutting to the C-terminal size of only the 3 aromatic amino acids.)
c=0 OH CH2 H CH2 H CH, H. H-Nt CH' CH N. CH CH CH' H CH CH3 H CH H CH2 CH, CH, CH2 CH2 CH3 CH2 CH2 * NH3
Consider the following two peptides: I. N-Pro-Pro - Glu - Glu - Tyr - His - Cys - Ala - Glu - Gln - Lys - Leu - Ser - Ser - Phe-Leu- Thr - C II. N-Pro-Pro - Lys - Arg - Gly - Tyr - His - Gly - Glu - Asp - Glu - Asp - Glu - Ser - Gly-Phe- Tyr-C Give three reasons why_peptide I is more likely to form an alpha helix in aqueous solution at pH 7.0. Your reasons may include why_peptide Il is less likely to form an alpha helix
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
Amino Acid 3-Letter 1-Letter Second letter Code Code Alanine Cysteine Aspartic acid or aspartate Glutamic acid or glutamate | Phenylalanine Glycine Histidine Ala Cys Asp Glu UCU Phe UGU cys UGC UUUT UAU Tyr UAC D UUC UC Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp G UCA Phe Leu UUG UCG Gly G H. His Ile CUU CCU CAU CGU U His CAC CÚC Leu CUA CGC CGA Isoleucine Lysine Leucine Pro Arg Lys K CAA Gin CAG CCA Leu L. CUG CCG CG Methionine Met M AUU AUC le ACU) ACC AAU1 AAC AGU Asn Asparagine Proline Glutamine Arginine Serine Asn Ser AGC AGA Arg Pro P. Thr AAA Gln Arg Ser AUA ACA AUG Met ACG AAG Lys AGG R GUU) GCU) GAU1 GGU GGC Gly Threonine Valine Tryptophan Tyrosine Thr GUC Val GUA GCC Ala GCA Val V GAA GAG GGA W Trp Тут Glu GUG GCG GGG Y Apply all that you have learned to solve the following: If you have the following DNA sequence: 5-ATGGCIOTOGTATTAAATAG-3 1. What is the sequence of the bases in the complementary DNA strand in a 3' to 5 direction ?( NB" Just type the letter for the bases) 2.…
Here is a putative peptide sequence (position number on top of residues): 1 2 3 4 5 6 7 8 9 10 11 12 13 NH2- G C G N V T H N Q C V L S -COOH If expressed in a eukaryotic cell (please mark your answer in the blank space): Position(s) ___ could be N-glycosylated Position(s) ___ could be modified with myristic acid and the bond formed would be a ______________ Position(s) ______and _____ could be modified with palmiti c acid and the bond formed would be a ______________ Positio n(s) ________ could be a segment of a lipid-linked protein with a farnesyl anchor and the bond formed would be a ______________ Position(s) ________ could be a segment of an O-glycosylated protein Position(s) ________ could be modified with a glycosylphosphatidylinositol (GPI) anchor Position(s) ________ could be phosphorylated
Many enzymes are switched "on" by attachment of a phosphate group at a specific serine somewhere on the protein (phosphorylation). The basic reaction is: E + ATP2 Ep + ADP Po SERINE PHOSPHO SERINC (Note the "squiggles" before the backone amide and carbonyl indicate the polypeptide chain continues on either side of the serine). For phosphorylation to have this effect, there has to be some equilibrium between inactive and active forms conformations of the enzyme: [Eactive] [Einactive] Einactive 2 Eactive; K* The same basic equilibrium must exist for the phosphorylated protein: [Ep,active] [Ep,inactive] EP,inactive 2 Ep,active; Kp = (a) If phosphorylation increases the measured activity of the enzyme, is K* or K larger? Why? (b) Does the phosphorylation site need to be near the site where the enzyme binds its substrate (e.g. the reactant whose chemistry it catalyzes)? Why or why not?
Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)
Translate the following amino acid sequence into one-letter code: Glu-Leu-Val-Ile-Ser-IleSer-Leu-IleVal-Ile-Asn-Gly-Ile-Asn-Leu-Ala-SerValGlu-Gly-Ala-Ser
A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS