Give the principles involved in the following: (1-2 sentences each only) 1% glucose medium 1% fructose medium 1% galactose medium 1% sucrose medium 1% lactose medium
Q: Ninhydrin is a compound that is commonly used in forensic identification, because it turns purple in…
A: Ninhydrin is a compound used in forensic identification to detect the presence of amino acids in…
Q: explain Knee jerk reflex
A: A reflex is an automatic, near-instantaneous response to a stimulus that occurs without conscious…
Q: Observe the number of hydroxyl groups on cellulose, starch, and glycogen. What can the number of -OH…
A: Carbohydrates are sugars composed of Hydrogen, Oxygen, and Carbon atoms. These plays important role…
Q: 19. When a stressor first occurs, the body responds by causing preterm labor decreasing the function…
A: Introduction : On top of each kidney are two triangular glands called adrenal glands. The gland is…
Q: Mentions topics related to zootechnics
A: Zootechnics, also known as animal science or animal husbandry, is a branch of agriculture that…
Q: Introduction for chick embryo
A: Introduction: The growing embryo of a chicken is known as a chick. It is a common model organism in…
Q: What impacts upon the giant sequoia tree ecosystem do humans have? Do growing human populations…
A: Introduction: The giant sequoia tree ecosystem is a unique and ancient ecosystem that has existed…
Q: Complete the following statements by selecting one of the options provided. A mutation that…
A: The series of events that take place in a cell to divide it into two daughter cells is known as cell…
Q: You study the differentiation of embryonic cells into astrocytes, a process that takes a few days in…
A: Living cells are used in biotechnology to produce a variety of products, such as vaccines,…
Q: a positive-feedback system is one in which a. a variable is charged in the opposite direction to…
A: Feedback happens when the final result in a pathway or process directs the action of the cycle that…
Q: What is the difference in ATP yield per glucose molecule between the malate-aspartate shuttle and…
A: Introduction ATP (adenosine triphosphate) is a high-energy molecule that serves as the primary…
Q: What is unusual about the receptor for steroid hormones? A. The receptor is located in the cytoplasm…
A: Steroid hormones are lipid-soluble signaling molecules that diffuse across the plasma membrane to…
Q: In this discussion, you will discuss the evolutionary advantages of the amniotic egg. Explain how…
A: Introduction: The process through which a species acquires traits or characteristics that enhance…
Q: Which of the following statements accurately describes the process of DNA replication? A. The two…
A: DNA replication is a process in which DNA reproduces to form daughter strands. This usually occurs…
Q: After cells have attached to plastic, they begin to spread across the plastic. What molecules in or…
A: Cell-to-matrix interactions refer to the interactions between a cell and the extracellular matrix…
Q: the discussion section the authors wrote “The prevailing hypothesis about the action of tACS is the…
A: Hypothesis can be classified into two- alternate hypothesis and null hypothesis. Alternate…
Q: A human female who is heterozygous of the sex-linked trait causing red-green color blindness marries…
A: As a sex-linked characteristic, colour blindness is caused by a gene which is found on the sex…
Q: You have isolated several mutants that behave normally at low temperature, but at high temperatures…
A: During the process of the cell cycle, the cell undergoes a multistep process and finally divides…
Q: what are the positive and negative results of the flagella stain procedure
A: Introduction: Flagella are the thread-like appendages that some bacteria utilise for locomotion, and…
Q: State and explain the virus family and their subfamilies especialliy those that have suffix of "ae".
A: Introduction :- Viruses are infectious agents that are not classified as living organisms because…
Q: Use the information in Table 1 to describe how Hispanic Americans compare to non-Hispanic White…
A: Introduction Prevalence is a statistical term that refers to the proportion of individuals in a…
Q: the primary structure of proteins is held together by a. covalent bonds b. hydrogen bonds c.…
A: Proteins are very important for us. Proteins are large molecules made up of chains of amino acids,…
Q: The functions of the cell part labeled “Z” include — Answer A holding and protecting the…
A: Different cell structures and organelles have different functions, and the function of a cell part…
Q: the cytosolic leaf of the smooth ER. How does this not destabilize the ER and cause damage? How does…
A: Smooth endoplasmic reticulum is devoid of any ribosomes on its surface hence it is smooth. It helps…
Q: a A B 80 చి C Which plate(s) show a PURE culture? +
A: Introduction : Each bacterium when inocuated in the culture media grows and divides to form one…
Q: You did not answer the question. I needed to know hypothetically where on this tree the fictional…
A: Evolutionary tree or a phylogenytic tree contains several groups according to their evolutionary…
Q: The codon UAG is known as a stop codon, and signals the reader to end translation for that protein.…
A: ANSWER) The stop codons signals the reader to stop the protein translation process, these codons are…
Q: Provide a illustation/diagram
A: Anaemia: In human beings, the oxygen in the blood is carried with the help of red blood cells. This…
Q: Stochastic events change both the gene pool and gene frequencies over time. True False
A: A population's genetic makeup evolves throughout time as a result of evolution. In nature, chance…
Q: How many coccus cells (0.0005 mm in diameter) could fit across the entire FOV of the 100x objective…
A: Introduction Magnification is the ratio of the apparent size of an object to its actual size. In…
Q: Carotenes Xanthophylls Chlorophyll a Chlorophyll b now what happens if we change put water…
A: Pigments: Plant pigments are colored compounds produced by plants that are responsible for their…
Q: Describe one of the medications that helps regulate dopamine and considerations related to patient…
A: Dopamine is a type of neurotransmitter, which is a chemical that transmits signals between neurons…
Q: Answer the following questions: 1. What was the first antibiotic and what was its importance? 2.…
A: As per bartleby guidelines only 3 questions can be answered. Please post remaining questions…
Q: Are there any nutritional risks vegetarians should be aware of?
A: Introduction :- Vegetarians are individuals who abstain from eating meat, poultry, and seafood, and…
Q: Researchers wanted to set up a study to see if temperature was related to plant growth in tomato…
A: Introduction A hypothesis is a proposed explanation or prediction for a phenomenon or a set of…
Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…
A: Cell signaling is the process by which cells communicate with each other and respond to signals from…
Q: DNA is read from the 5' to 3' end. True False
A: DNA DNA stands for Deoxyribonucleic Acid, and it is a long, double-stranded, helical molecule that…
Q: What is the probability of the marriage of a Carrier of Beta thalassemia and a Carrier of sickle…
A: Both Sickle Cell anaemia and beta Thalassemia follows autosomal recessive inheritance pattern. This…
Q: 4. Which of the following is not a way a pregnant woman could potentially come in contact with lead,…
A: Introduction Birth defects are abnormalities that occur in a baby's body structure or function…
Q: 5. Which of the following is a chromosomal condition? O hemophilia Down syndrome O color blindness O…
A: A chromosomal condition is a type of genetic condition that results from an abnormality in the…
Q: tructing a Cladogram Tools Extensions Help Background Layout Theme Transition Feathers: cardinal D…
A: Cladogram is a representation of various evolutionary inter relationships among different organisms.…
Q: Organism interactions with the environment Complete the following statements about how organisms…
A: Organisms interact with their environment in many ways to obtain resources necessary for their…
Q: Which statement is false? An auxotrophic mutant requires at least one nutrient for growth Bacterial…
A: Introduction Bacteria are a type of unicellular microorganisms that belong to the domain Bacteria.…
Q: What is the positive and negative result in Physical Growth Requirements, temperature, osmotic…
A: Introduction :- Growth refers to the process of increasing in size, mass, and complexity over time.…
Q: Identify the arrowed from a urine sediment microscopy
A: Testing urine can provide important information about an individual's overall health and help…
Q: You recently got strep throat, caused by streptococcal bacteria. You took antibiotics, and your…
A: Introduction :- Streptococcus is a genus of Gram-positive bacteria that can cause a wide range of…
Q: Explain what would happen to a red blood cell that is placed in the following solutions: a)…
A: A solution is generally composed of two components that are solvent (liquid mostly) and solute…
Q: Consider an autosomal dominant trait with reduced penetrance and complete expressivity. What might…
A: An autosomal dominant trait is a genetic condition where the presence of a single copy of the…
Q: Ninhydrin is a compound that is commonly used in forensic identification, because it turns purple in…
A: Ninhydrin is a compound used in forensic identification to detect the presence of amino acids in…
Q: The Warburg effect is generally observed in cancer cells as a consequence of pyruvate dysmetabolism.…
A: Introduction :- p53 is a tumor suppressor protein that plays a critical role in regulating cell…
Give the principles involved in the following: (1-2 sentences each only)
- 1% glucose medium
- 1% fructose medium
- 1% galactose medium
- 1% sucrose medium
- 1% lactose medium
Step by step
Solved in 2 steps
- Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?Describe each step of the metabolic pathway shown in the image below. Linoleic Acid Metabolism 18:2n-6, HO. Linoleic Acid 18:3n-6 он Gamma Linolenic Acid 20:3n-6 он Dihomo Gamma Linolenic Acid 20:4n-6 HO, Arachidonic Acid 22:4n-6 но, Docosatetraenoic AcidMany people who are lactose intolerant can eat yogurt, which is prepared from milk curdled by bacteria, without any digestive problems. Give a reason why this is possible. (Hint: Read the label on each of several yogurt containers. Do the ingredients make a difference?)
- Lifting 5 Kg consumes 110 moles ATP. Which of the following metabolites, when oxidized in muscle cells will provide this energy? 17:0 fatty acid 16:0 fatty acid 18:1 fatty acid trisaccharide glycogen 50 glucose units (anaerobic) -What is the usual product of fatty acid synthase in the cytoplasm? palmitate oleate stearate 4 linoleate -) (2) 3)give a detailed overview of how tryglycerides are metabolized under aerobic conditions. note the steps involved and the specific reactants and products of each step.
- Describe the breakdown of sucrose in the body and the revelant pathways of the byproducts. In the breakdown, be sure to use the following terms: active site, disaccharide, enzyme-substrate complex, fructose, glucose, glycosidic bond, hydrolysis, product, substrate, sucrase (the enzyme that splits sucrose), and sucrose. Also explain what happens to glucose and fructose in the liver.Fructose is a labeled on its anomeric carbon with 14C. This labeled fructose is added to muscle cells under anaerobic glycolytic conditions, and the secreted lactate is collected. Which carbon in the secreted lactate (shown below) contains the 14C label? دیده OH Carbon 2 Carbon 1 Carbon 3 No carbon contains the label.With respect to the following pairs of biomolecules which is produced via a mutarotation? D-Fructose and L-Fructose a-D-Fructose and 3-L-Glucose a-D-Mannose and 3-D-Mannose O a-D-Fructose and 3-L-Fructose O D-Fructose and D-Glucose
- Explain what happens to milk proteins during the formation of yogurt. (HInt: yogurt is made by fermentation of milk by bacteria, typically Lactobacillus bulgaricus and Streptococcus thermophillus. The bacteria convert milk sugar to lactic acid.)Define lactoseÑame the specific molecules that are produced when sucrose is broken down