Q: Nutrients in the soil, such as phosphorus and potassium, play an important role in plant…
A: “Nutrients are the compounds required and that provide energy, allowing to heal and in the…
Q: Briefly explain the generation and conduction of nerve impulse.
A: Introduction Neurons:- It is the structural and functional units of the nervous system of humans…
Q: Calculate for the water activity of the soy sauce in 80.3% ERH. Suppose the soy sauce is subjected…
A: Water activity is measure of energy status of water in a system.If more energy then microbial…
Q: Which of the following is NOT a true statement? Action potentials are generated only when a neuron…
A: There are few important points that should be kept in mind: Neurons possess electrical excitability…
Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…
A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…
Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…
A: 2 deoxyglucose is analogous to glucose but its hydroxyl group reduce in hydrogen thats why it's not…
Q: Which 2 systems work together to bring in and deliver oxygen to the cells and get rid of carbon…
A: Introduction :- The circulatory system transports wastes and supplies oxygen and nutrients to cells.…
Q: populations of flightless grasshoppers (Population A and B) are separated by a river that contains…
A: This is a type of natural selection occurring here. Natural selection was a concept given first by…
Q: Gene A encodes for a protein A which prevents exit from the G1 phase of the cell cycle. You are…
A: Cancer is the uncontrolled cell division that is highly under the control of genes. Cell cycle is a…
Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…
A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…
Q: STUDY QUESTIONS 1. List down at least 3 differences in the anatomy of male and female frogs. 2. How…
A: Frogs are amphibians and humans are mammals.
Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…
A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…
Q: Central self-tolerance in the immune system arises when maturing T cells in the thymus undergo…
A: Apoptosis is a process of natural cell death. T cells are matured in Thymus but are born in Bone…
Q: design a bacterial/archaeal species, what would be its characteristics (e.g. shape, arrangement,…
A: Bacteria are small unicellular microorganism that lacks any proper cell organization (which means no…
Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…
A: This question is about gene.
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Shown in the figure, is a portion of the electron transport chain pathway, in which electrons are…
A: Introduction An electron transport chain is a collection of protein complexes and other molecules…
Q: how the genes are related to intellectual disability in details
A: Answer :- As we know that incorporates Fragile X disorder (FXS), the most well-known acquired type…
Q: You have cloned the protein coding region of the porin gene from a phage into a bacterial cell for a…
A: Generally the phage viruses don't have a transcription or replication machinery they are dependent…
Q: Match the following hormones with their actions: ACTH epinephrine testosterone ADH estradiol…
A: INTRODUCTION Answers to question 1-10 is given below.
Q: what is a creation myth? why is knowing the creation myths important
A: What is creation myth- A creation myth is the narrative about how people came to inhabit and how…
Q: The following are words used in animal testing and its alternative methods. Define the following…
A: Vivisection: It is basically done as an experimental activity for study purpose. Here animals are…
Q: A mile-wide river separates two rabbit populations for a million years. Over time, one population…
A: "Genetic variation" is the result of the recombination of genetic material during the inheritance…
Q: O This organism is in the same Phylum as which of the following organisms? O jellyfish Osea urchin…
A: Snails are small, shelled creatures that roam this world. In their scientific classification, they…
Q: a certain family with both parents affected with Heberdon’s nodes, a single gene trait characterized…
A: There are many four different modes of inheritance autosomal dominant, autosomal recessive, X linked…
Q: Genetic problems: Use the diagram below to figure out how each monosomy or trisomy can a) Normal X…
A: 1) Trisomies and monosomies are two types of chromosomal abnormalities. Specifically, a trisomy is…
Q: Give a specific example on how to use UV-Vis spectrophotometer in Cosmetic Science. Provide a…
A: The UV/Vis spectrophotometer is thermo Scientific Multiskan SkyHigh Microplate Spectrophotometer.…
Q: B) You cross another heterozygous (AaBb) female bunny, Penny, whose haplotype you do not know. If…
A: A test cross is a trial cross of a singular organism of dominant phenotype of unknown genotype and…
Q: 1. A color-blind man married a normal woman. Their daughter, who was phenotypically normal, married…
A: XC = normal X chromosome Xc =Color-blind X chromosome 1). first cross A color-blind man(XcY) X a…
Q: Which option is a nonrenewable source of energy Petroleum Sunlight Water Wind
A: We used energy from our environment to do verious work. For light, heat, current, industry we used…
Q: 10. In class we discussed 3 types of plant and animal defenses (not mimicry), name one and give an…
A: Plants represent a rich source of nutrients for many organisms including bacteria, fungi, protists,…
Q: A worker spends 16 hours per week for 10 weeks in an area with 1.2 WL of radon daughters. a) What is…
A: Radon daughters enter the body with the inhaled air. The alpha particle dose to the lungs depends on…
Q: Anther Filament- Banner -Wing Peta Keel petal
A: A flower contains two types of reproductive parts : Female: Stigma, Style, Ovary (Pistil) Male:…
Q: discribe the various measures of strength of biological materials
A: For the measurements of biological materials strength various type of unit are used... 1. Like ATP…
Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…
A: "Transcription" and "Translation" are two important processes that take place inside the cell for…
Q: which protein interacts with RNA polymerase, in order to allow RNA polymerase to cleave RNA using…
A: SII a protein, interacts with RNA polymerase, in order to allo RNA polymerase (ll mainly) to cleave…
Q: LDL LDLR LDLR LDLR ( Which mouse has higher blood cholesterol between mice in lanes 1 and 2?…
A: Western blot : It is a technique used to identify and locate proteins based on their ability to…
Q: The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three…
A: Introduction The lactose operon (also known as the lac operon) is a group of genes present in E.…
Q: Explain why it is not always a good idea for an elderly person to lose weight, even if they have a…
A: Body mass index (BMI) is a screening tool that measures the ratio of your height to your weight.…
Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…
A: The renal system's primary activities include the management of ECF volume and blood pressure, the…
Q: What are the principle and basic concepts of NEGATIVE staining?
A: Introduction Staining is a technique for enhancing contrast in material, usually on a microscopic…
Q: Jim hasn't been having success in growing strawberry plants for the past few years, so he got his…
A: The observation of the following experiment conducted by Jim is there is some problem with the soil…
Q: Based on the Cytochrome C data, which organism is most closely related to humans? 2. Do any of the…
A: Answer
Q: Define epigenetic inheritance
A: Epignetic markers in the cell occurs in the form of DNA methylation, histone tail modifications like…
Q: How can you tell someone’s social class? What indicators can be misleading?
A: A group of members present in a society divided on the basis of their social and economical status…
Q: What volume of 10X TBE buffer should you use to make 100mL of 1X TBE buffer? 10mL 1mL 0.1mL 100mL
A: TBE buffer stands for Tris-Borate-EDTA buffer. It is used for both agarose and polyacrylamide gel…
Q: 9. Explain how a small amount of growth factor can mediate an amplified signal inside the cytoplasm…
A: Signal transduction pathways translate signals received at the cell's surface into cellular…
Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…
A: Metabolic syndrome is a group of disorders that occur in tandem and increase your risk of heart…
Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…
A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…
Q: Intracellular morphogens 1. 2. 3. 4. 1. 2. 3. 4. 234 Extracellular morphogens
A: Morphogens are the signallung molecules thar spread through the developing tissues and results in…
Step by step
Solved in 2 steps
- Explain in detail Muscarinic receptors in regards to the hisamine agonist. How do they cause smooth muscle contraction. Provide mechanismActions of neuropeptides include all the following, except :-a- inhibition of gene transcriptionb- decreased cyclic AMP synthesisc- changing intracellular Ca ++ leveld- activation of ligand-gated receptorsexaplin the intracellular mehcanims of smooth msucle via agonist such as Hitamine and acytycholine. link hisamine to muscarnic recptors link acetycholine to a neurotransmittors Give a diagram for each.
- Illustrate how and when histamine occur as a neurotransmitter.Trace the sequence of events in signal transduction for each of the following second messengers: cyclic AMP, inositol trisphosphate (IP3 ), diacylglycerol (DAG), and calcium ions.A quanta holds about 10,000 molecules of ACh. How many quanta are exocytosed during a single presynaptic AP? What controls or determines the total number of quanta released? Is this under physiological control?
- Define electrochemical gradients and the term “polarized”, and describe the electrochemical basis of the resting membrane potential including the function of the sodium-potassium pump in maintaining the resting membrane potential.Summarize neuron communication from the moment of receptor stimulation to the response of an effector, such as a muscle fiber, and define neurotransmitter, resting membrane potential, and current. Define electrochemical gradients and the term “polarized”, and describe the electrochemical basis of the resting membrane potential including the function of the sodium-potassium pump in maintaining the resting membrane potential. Describe graded potentials including hyperpolarizing and depolarizing graded potentials. Describe action potentials (nerve impulses) including: Thresholds All-or-none principle Phases of action potential generation Refractory periodAt the peak of the action potential, Vm is approximately -65 mV. Assuming normal intracellular and extracellular K+ concentrations (refer to the table), (1) calculate the driving force (in mV) that acts on K+ ions and (2) use the information obtained in part 1 to determine the direction in which K+ ions will flow (i.e., into the cell or out of cell)
- Define resting membrane potential and describe its electrochemical basis. Briefly discuss changes to resting membrane potential. Provide specific examples of how the 4 essential concepts relative to resting membrane potential or disruption of resting membrane potential.A GRK inhibitor would have what effect on GPCR inactivation in the presence of a GPCR agonist? (a) it would decrease it; (b) it would maintain the same rate of inactivation; (c) it would increase it.Give an account of signalling at a neuromuscular junction through the nicotinic acetylcholine receptor.