The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA. Introduction: A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Question

Want to see more full solutions like this?

Answer 1

Question

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'

draw mRNA sequence for the following sequence ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG

Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'

Answer 2

Question

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Question

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Question

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Answer 6

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Answer 7

Chapter 9, Problem 1LTB

Summary Introduction

To write:

The nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Introduction:

A nucleotide is formed from three components “pentose sugar, a phosphate group, and nitrogenous bases”. Nucleic acids are complex molecules found in living organisms. They are formed from the interaction of many nucleotides. These are DNA and RNA. DNA stands for “deoxyribonucleic acid” and RNA stands for “ribonucleic acid”

Answer 8

Expert Solution & Answer

Explanation of Solution

The process of conversion of DNA into a form of RNA (mRNA) is termed as transcription. DNA and RNA contain the same type of nitrogenous bases. However, thymine is replaced by another nitrogenous base uracil (U) in RNA.

Therefore, the RNA transcript formed from DNA with sequence CGATTACTTA is GCUAAUGAAG.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Conclusion

GCUAAUGAAG is the nucleotide sequence of RNA produced from the transcription of DNA with sequence CGATTACTTA.

Answer 12

Ch. 9 - Prob. 1LTB Ch. 9 - Prob. 2LTB Ch. 9 - Prob. 3LTB Ch. 9 - Prob. 4LTB Ch. 9 - Prob. 5LTB Ch. 9 - Prob. 6LTB Ch. 9 - Prob. 7LTB Ch. 9 - Prob. 8LTB Ch. 9 - Prob. 9LTB Ch. 9 - Prob. 10LTB

Explanation of Solution

Want to see more full solutions like this?

Chapter 9 Solutions