Concept explainers
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations.
- a. met-trp-
- b. met-cys-ile-val-val-leu-gln-
- c. met-trp-tyr-arg-ser-pro-thr-
- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
a.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codons allow the mRNA to transcribe the DNA template while stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The first mutation occurred and formed “met-trp” protein. Possibly, the mutation occurred at ‘tyr’, which resulted in the termination. The termination is caused by a stop codon. The possible triplet codons after mutation in “met-trp” are :
Met | Trp | Stop codons |
AUG | UGG | UAA |
UAG |
In the original sequence, tyrosine is present. However in mutated sequences, stop codons are formed, which shorten the polypeptide to Trp.
b.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-cys-ile-val-val-leu-gln”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The second mutation occurred and formed “met-cys-ile-val-val-leu-gln” protein. Possibly the point mutation occurred which caused changes in the reading frame. The triplet codons of the mutated protein “met-cys-ile-val-val-leu-gln” are :
Met | Cys | Ile | Val | Val | Leu | Gln |
AUG | UGU | AUA | GUG | GUC | CUA | ACU |
GUG | ACC | |||||
ACA | ||||||
ACG |
The highlighted codons are mutated. The single place deletion or insertion may arise this type of situation where the complete sequence is changed.
c.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-ser-pro-thr”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The third mutation occurred and formed “met-trp-tyr-arg-ser-pro-thr” protein. Possibly the frameshift mutation occurred, which caused changes in the reading frame. The triplet codons of the mutated protein “met-trp-tyr-arg-ser-pro-thr” are :
Met | Trp | Tyr | Arg | Ser | Pro | Thr |
AUG | UGG | UAU | AGA | AGU | CCU | ACU |
UAC | AGG | CCC | ACC | |||
CCA | ACA | |||||
CCG | ACG |
Here, the only codon for glycine is completely changed. The single frame is inserted and deleted from the same place.
d.
To determine: The DNA and mRNA sequences that code for this normal protein “met-trp-tyr-arg-gly-pro-thr” and explain the mutation in “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-”.
Introduction: The proteins are coded from triplet codons. There are 64 triplet codons, which code for 20 amino acids in which initiation and stop codons are also included. The initiation codon allows the mRNA to transcribe the DNA template; whereas, the stop codons restrict the translation.
Explanation of Solution
The possible triplet codons for the normal protein “met-trp-tyr-arg-gly-pro-thr” are as follows:
Met | Trp | Tyr | Arg | Gly | Pro | Thr |
AUG | UGG | UAU | AGA | GGU | CCU | ACU |
UAC | AGG | GGC | CCC | ACC | ||
GGA | CCA | ACA | ||||
GGG | CCG | ACG |
These are the possible triplet codons for “met-trp-tyr-arg-gly-pro-thr” protein. Any mutation in the above sequences may lead to mutation.
The second mutation occurred and formed “met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-” this protein. This is a type of mutation where the reading frame is shifted because this protein is relatively larger than the normal protein.
Hence, frame insertion is a possible way due to which the protein is completely changed.
Want to see more full solutions like this?
Chapter 9 Solutions
HUMAN HEREDITY (LL)-W/MINDTAP ACCESS
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forwardA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward
- Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC TСС САТ СТТ ААС AAА GAG GTT GGC ТАТ ТТТ Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: ATG CGC TCC CAT CTT AAC CAA AGA GGT TGG CTA TTT T Protein: Met-Arg-Ser-His-Leu-Asn-Gln-Arg-Gly-Trp-Leu-Phe- missense nonsense antisense O frame-shift silentarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forwardConsider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forward
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Glarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Proarrow_forward
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Glyarrow_forwardA protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. a. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results? b. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?arrow_forwardA sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning