Concept explainers
Refer to the figure to answer these questions:
a. Add labels for mRNA (including the 5' and 3' ends) and tRNA. In addition, draw in the RNA polymerase enzyme and the ribosomes, including arrows indicating the direction of movement for each.
b. What are the next three amino acids to be added to polypeptide b?
c. Fill in the
d. What is the sequence of the DNA complementary to the template strand (as much as can be determined from the figure)?
e. Does this figure show the entire polypeptide that this gene encodes? How can you tell?
f. What might happen to polypeptide b after its re lease from the ribosome?
g. Does this figure depict a prokaryotic or a eukaryotic cell? How can you tell?
(a)
To add:
The labels for
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
The
(b)
To determine:
What are next three amino acids to be added in polypeptide b.
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
Amino acid is an organic compound which serves as the basic building block of protein. It binds together with peptide bond to form protein, which performs specific function in body. It codes for amino acid methionine, serine and valine.
(c)
To fill:
The nucleotide in the
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
The
(d)
To determine:
What is the sequence of DNA, which is complementary to the template strand.
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
The template DNA strand is
(e)
To determine:
Does this figure show the entire polypeptide that this gene encodes. How can you tell this.
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
No, this is not the entire polypeptide chain that is coded by gene because this chain only contains initiation codon such as
(f)
To determine:
What might happen to polypeptide b after it releases from ribosome.
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
When polypeptide b is released from ribosome, the process of protein synthesis is terminated and complete protein is synthesized and ready for gene expression. Ribosome helps in binding amino acids together to form a polypeptide chain.
(g)
To determine:
Does this figure depict the prokaryotic or eukaryotic cell. How can you tell.
Concept introduction:
A polypeptide chain is formed during the process of translation. In this process, the
Explanation of Solution
Pictorial representation: Fig.1: The nucleotide sequence
Fig.1: The nucleotide sequence.
Explanation:
This figure represents the prokaryotic cell because in prokaryotic cell, both the transcription and translation process occur simultaneously, while in eukaryotic cell, the transcription and translation processes occur at different space and time.
Want to see more full solutions like this?
Chapter 7 Solutions
BIOLOGY
Additional Science Textbook Solutions
Campbell Essential Biology with Physiology (6th Edition)
Anatomy & Physiology
Human Anatomy & Physiology (Marieb, Human Anatomy & Physiology) Standalone Book
Microbiology: Principles and Explorations
Human Biology: Concepts and Current Issues
Microbiology: An Introduction (13th Edition)
- Please consider the figure below. a. Give the name of the process illustrated in the figure. b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B, C and/or D to answer the question. C. What terminus of the protein is represented by the amino acid represented by label D?arrow_forwardWhich sequences are spliced out of the mRNA strand before leaving the nucleus? In other words, which sequences are not part of the code for the amino acids? a. exons b. intronsarrow_forwardFor each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Specifies the order of amino acids in a protein, using a series of three-base codons, where different amino acids are specified by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.arrow_forward
- Use the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.arrow_forwardThe following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' O b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] Ob. Tyr - Arg - Met - Phe - Thr - [STOP] O C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above O O O Oarrow_forward
- Given: 3' TAC CAG TTA AGC CTC GGT ATC CAG GAT ACG 5' What would be the first 10 bases at the 5' end of the complementary strand? A. 5' TCG CGTATC C 3' C. 5' GGC TTA ACT G 3' E. none of the choices B. 5' ATG GTC AATT 3' D. 5' CGT ATC CTG G 3' WRITE THE CAPITAL LETTER OF YOUR ANSWER.arrow_forwardThe following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' O e. 5' - AAUCCACUUGUACGCUAU - 3'arrow_forwardGiven the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:arrow_forward
- Select the description of an intron. (If possible, please explain why it is that answer) a.) sequence of adenine nucleotides added onto the end of pre‑mRNA b.) modified form of a guanine nucleotide added onto the end of pre‑mRNA c.) coding portion of a DNA sequence that is present in mature mRNA d.) noncoding portion of a DNA sequence that is removed from pre‑mRNAarrow_forwardGiven the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA molecule. B. Transcribe the original DNA strand (TACAGAGATAACCGAATT) and write the sequence of bases found in the resulting messenger RNA molecule. C. Translate your messenger RNA molecule and write the sequence of amino acids in the resulting protein (the genetic code is provided below).arrow_forwardb) Use the DNA sequence bęlow to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education