Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 5.16, Problem 2MQ
How does a reducing agent work? Give an example of a reducing agent.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 5 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 5.1 - Summarize the steps that lead up to binary fission...Ch. 5.1 - Define the term generation. What is meant by the...Ch. 5.2 - Prob. 1MQCh. 5.2 - Prob. 2MQCh. 5.2 - Prob. 3MQCh. 5.3 - Prob. 1MQCh. 5.3 - Prob. 2MQCh. 5.3 - Prob. 3MQCh. 5.4 - What are autolysins and why are they necessary?
Ch. 5.4 - What is the function of bactoprenol?
Ch. 5.4 - What is transpeptidation and why is it important?
Ch. 5.5 - What is a semilogarithmic plot and what...Ch. 5.5 - Prob. 2MQCh. 5.5 - Prob. 3MQCh. 5.6 - In which phase of the growth curve do cells divide...Ch. 5.6 - Prob. 2MQCh. 5.6 - Prob. 3MQCh. 5.7 - How do microorganisms in a chemostat differ from...Ch. 5.7 - What happens in a chemostat if the dilution rate...Ch. 5.7 - Do pure cultures have to be used in a chemostat?Ch. 5.8 - What are some of the problems that can arise when...Ch. 5.8 - Using microscopic techniques, how could you tell...Ch. 5.9 - Why is a viable count more sensitive than a...Ch. 5.9 - Describe how you would dilute a bacterial culture...Ch. 5.9 - Prob. 3MQCh. 5.10 - List two advantages of using turbidity as a...Ch. 5.10 - Describe how you could use a turbidity measurement...Ch. 5.11 - How does a hyperthermophile differ from a...Ch. 5.11 - Prob. 2MQCh. 5.11 - E. coli can grow at a higher temperature in a...Ch. 5.12 - Prob. 1MQCh. 5.12 - What molecular adaptations to cold temperatures...Ch. 5.13 - Which phylogenetic domain includes species with...Ch. 5.13 - How does the membrane structure of...Ch. 5.13 - What is Taq polymerase and why is it important?Ch. 5.14 - How does the concentration of H+ change when a...Ch. 5.14 - What terms are used to describe organisms whose...Ch. 5.15 - What is the aw of pure water? What is the lower...Ch. 5.15 - What are compatible solutes, and when and why are...Ch. 5.16 - How does an obligate aerobe differ from a...Ch. 5.16 - How does a reducing agent work? Give an example of...Ch. 5.16 - How does Superoxide dismutase or superoxide...Ch. 5.17 - Why is heat an effective sterilizing agent?Ch. 5.17 - What steps are necessary to ensure the sterility...Ch. 5.17 - Distinguish between the sterilization of...Ch. 5.18 - Define D10 and explain why the killing dose for...Ch. 5.18 - Prob. 2MQCh. 5.18 - Prob. 3MQCh. 5.19 - Distinguish between the antimicrobial effects of...Ch. 5.19 - Describe how the minimum inhibitory concentration...Ch. 5.19 - Distinguish between a sterilant, a disinfectant,...Ch. 5 - Prob. 1RQCh. 5 - Describe the role of proteins present at the...Ch. 5 - Prob. 3RQCh. 5 - Describe how new peptidoglycan subunits are...Ch. 5 - Prob. 5RQCh. 5 - Describe the growth cycle of a population of...Ch. 5 - How does a chemostat regulate growth rate and cell...Ch. 5 - How does a viable count differ from a total count?Ch. 5 - How can turbidity be used as a measure of cell...Ch. 5 - Prob. 10RQCh. 5 - Prob. 11RQCh. 5 - Concerning the pH of the environment and of the...Ch. 5 - How does a halophile maintain positive water...Ch. 5 - Prob. 14RQCh. 5 - Prob. 15RQCh. 5 - Contrast the terms thermal death time and decimal...Ch. 5 - Prob. 17RQCh. 5 - Prob. 18RQCh. 5 - Prob. 19RQCh. 5 - Describe the procedure for obtaining the minimum...Ch. 5 - Prob. 21RQCh. 5 - A medium was inoculated with 5 106 cells/ml of...Ch. 5 - Escherichia coli but not Pyrolobus fumarii will...Ch. 5 - In which direction (into or out of the cell) will...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license