Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5, Problem 7TYU
Which of the following pairs of base sequences could form a short stretch of a normal double helix of DNA?
(A) 5′-AGCT-3′ with 5′-TCGA-3′
(B) 5′-GCGC-3′ with 5′-TATA-3′
(C) 5′-ATGC-3′ with 5′-GCAT-3′
(D) All of these pairs are correct.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.)
a) 5’- G A G C G A T C G C T C - 3’
b) 5’- G A G C G A G A G C G A - 3’
c) 5’- G A G C G A A G C G A G - 3’
You prepare a reaction mix containing (i) DNA polymerase III, (ii) DATP, DCTP, dGTP, Mg2+, and
2,3'dideoxy-TTP (called ddTTP*), (iii) a short primer with the sequence 5'-CCTG-3, and (iv) a source
DNA fragment with the sequence, 5'-AATCGTTCACGTTAGCAGG-3. What is the product of this
reaction?
Note that in ddTTP, both the 2' and 3' positions on the ribose sugar lack hydroxyl groups.
No reaction, because the primer is not complementary to any sequence in the source DNA.
O CCTGCT
O CCTGC
O T'T'AGCAAGT'GCAAT CGTCC
O CCTGCT'AACGT GAACGAT'T
Chapter 5 Solutions
Campbell Biology (11th Edition)
Ch. 5.1 - What are the four main classes of large biological...Ch. 5.1 - How many molecules of water are needed to...Ch. 5.1 - WHAT IF? If you eat a piece of fish, what...Ch. 5.2 - Write the formula for a monosaccharide that has...Ch. 5.2 - Prob. 2CCCh. 5.2 - WHAT IF? After a cow is given antibiotics to...Ch. 5.3 - Compare the structure of a fat (triglyceride) with...Ch. 5.3 - Why are human sex hormones considered lipids?Ch. 5.3 - Prob. 3CCCh. 5.4 - What parts of a polypeptide participate in the...
Ch. 5.4 - Prob. 2CCCh. 5.4 - WHAT IF? Where would you expect a polypeptide...Ch. 5.5 - DRAW IT Go to Figure 5.23a and, for the top three...Ch. 5.5 - DRAW IT In a DNA double helix, a region along one...Ch. 5.6 - How would sequencing the entire genome of an...Ch. 5.6 - Given the function of DNA, why would you expect...Ch. 5 - What is the fundamental basis for the differences...Ch. 5 - Compare the composition, structure, and function...Ch. 5 - Why are lipids not considered to be polymers or...Ch. 5 - Explain the basis for the great diversity of...Ch. 5 - What role does complementary base pairing play in...Ch. 5 - Prob. 5.6CRCh. 5 - Which of the following categories includes all...Ch. 5 - The enzyme amylase can break glycosidic linkages...Ch. 5 - Prob. 3TYUCh. 5 - The structural level of a protein least affected...Ch. 5 - Enzymes that break down DNA catalyze the...Ch. 5 - The molecular formula for glucose is C6H12O6. What...Ch. 5 - Which of the following pairs of base sequences...Ch. 5 - Construct a table that organizes the following...Ch. 5 - Prob. 9TYUCh. 5 - EVOLUTION CONNECTION Comparisons of amino acid...Ch. 5 - SCIENTIFIC INQUIRY Suppose you are a research...Ch. 5 - WRITE ABOUT A THEME: ORGANIZATION Proteins, which...Ch. 5 - SYNTHESIZE YOUR KNOWLEDGE Given that the function...
Additional Science Textbook Solutions
Find more solutions based on key concepts
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
What were the major microbiological interests of Martinus Beijerinck and Sergei Winogradsky? It can be said tha...
Brock Biology of Microorganisms (14th Edition)
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
1. The correct sequence of levels forming the structural hierarchy is
A. (a) organ, organ system, cellular, che...
Human Anatomy & Physiology (Marieb, Human Anatomy & Physiology) Standalone Book
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forwardGive the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b) ACCCA (c) GTGTCarrow_forwardWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAarrow_forward
- Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to 3′. (a) A-C-G-G-A and T-G-C-C-T (b) G-T-G-A-C and C-A-T-G-G(c) G-T-A-T-A and A-C-G-C-Garrow_forward1) How many bases are found (on one of the strands) in a single twist of a DNA helix: a) 3.4 b) 10 d) 0.34 2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V 3)Consider the following sequence: 5' - AUGGCUACAGAUAGCUGGGGCUGAAAAAAAAAAAAAAA..3'Translated, the corresponding protein contains how many amino acids: a) 6 b) 7 c) 8arrow_forwardThe base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G (a) What is the base composition of the complementary DNA chain? (b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?arrow_forward
- The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes tautomerization from its keto form to its enol form than does thymine. 5BU can be incorporated into newly synthesized DNA when it pairs with adenine on the template strand. However, the enol form of 5BU pairs with guanine rather than adenine. (a) Draw the 5BU · G base pair. (b) What type of mutation results?arrow_forward(a) Write the DNA double strand. (b) Assuming the gel pattern represents the template strand, transcribe and translate the DNA. (c) Write the anticodon sequence. A G 2nd (middle) Base of a Codon 1* 3rd U A G Base Base UUU - Phe U UUC - Phe UCU - Ser UCC - Ser UAU - Tyr UAC - Tyr UGU - Cys UGC - Cys UUA - Leu UCA- Ser UAA - STOP UGA - STOP UUG -Leu CUU - Leu CUC - Leu UCG-Ser CCU - Pro CCC- Pro UAG- STOP CAU - His САC - His UGG- Trp CGU - Arg CGC - Arg CGA - Arg CGG- Arg CỦA - Leu ССА-Pro CAA - Gin CAG- Gin AAU - Asn CUG - Leu CCG-Pro AUU - Ile ACU - Thr АCC - Th ACA - Thr AGU – Ser A AGC - Ser AGA - Arg AGG - Arg GGU - Gly GGC - Gly GGA - Gly GGG - Gly AUC - lle AAC - Asn AAA - Lys AAG - Lys GAU - Asp GAC - Asp GAA - Glu AUA- lle AUG - Met ACG - Thr G GUU - Val GCU - Ala GCC - Ala GUC - Val GUA- Val GCA - Ala GUG - Val GCG - Ala GAG - Glu PUAGPCAGUCACUCAG |arrow_forwardConsider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forward
- How many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if it is (a) single- stranded or (b) double-stranded?arrow_forwardb) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.arrow_forwardWhich of the following represents a missense mutation in the DNA coding strand sequence, 5' - AAACCTTTT - 3'? a) 5' - AAACCCTTT - 3' b) 5' - AAACCATTT - 3' c) 5' - AAACGTTTT - 3' d) 3' - AAACCTTTT - 5' e) 5' - AAACCGTTT - 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license