Concept explainers
Interpretation:
The reason corresponding to the fact that Taq polymerase is especially useful for PCR is to be stated.
Concept introduction:
The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR). This reaction forms millions duplicate copies of a specific DNA segment.
The enzyme Taq polymerase is a synthetic enzyme. It is used to generate DNA strands at a very fast rate than other polymerases enzymes.
Answer to Problem 1P
The enzyme, Taq polymerase, is especially useful for PCR because this enzyme is stable in the high temperature condition also and does not get denatured.
Explanation of Solution
The polymerase chain reaction (PCR) possesses the high temperature due to which the natural or other polymerases enzymes get destroyed.
The enzyme, Taq polymerase, is a heat-stable enzyme. It is one of the types of DNA polymerase that can be stable at the high temperature also. This enzyme is stable in the condition of protein-denaturing as well.
Thus, Taq polymerase is especially useful for polymerase chain reaction which takes place at high temperature.
The enzyme, Taq polymerase, is especially useful for PCR because this enzyme is stable in the high temperature condition also and does not get denatured.
Want to see more full solutions like this?
Chapter 5 Solutions
BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
- Genetically Modified Foods The creation of transgenic crop plants using recombinant DNA methods involves the transfer of just one gene or a small number of genes to the plants, in contrast to classical breeding methods in which hundreds or even thousands of genes are transferred at once. Explain why this is true. If fewer genes are transferred during the creation of transgenic crops, why are some people afraid that they are dangerous?arrow_forwardTrue or False. During gel electrophoresis, small DNA fragments are found towards the top of the gel True Falsearrow_forwardPCR uses a very special DNA polymerase, tell me where it came from and why it is special to PCR.arrow_forward
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardtrue or false. if microbe A or microbe B have the whole genome similarity of 68% as determined by DNA-DNA hybridazation, they should be considered the same species. motivate your answerarrow_forward
- This is DWA. You hope to clone an extinct animal species by taking the easy route - using museum bones or tissues. You extract the DNA and use PCR to amplify, then sequence all segments of the genome You are unsuccessful. Later you discover that the museum specimens have been treated with formaldehyde, which forms covalent bonds in DNA, where once there existed H-bonds. What step in your PCR reaction would be inhibited? g -S Knowing this, if a human was exposed to formaldehyde, what enzyme(s) of DNA replication in vivo would be prevented from doing their job?arrow_forwardDon't copy paste.arrow_forwardorganisms ha varieties. Through this process, several genetically (10) been produced. What I Can Do Activity 7: MATCHY MATCHY Direction: Match the purpose to the components found in the box below. Antibiotic Resistance Gene Multiple Cloning Site Promoter DNA Inserted Gene Sequence Multiple Cloning Site 1. Allows the controlled expression of the desired gene in the presence of an inducing agent (e.g., beta-galactosidase; heat treatment (~65°"C) 2. DNA sequence or portion for the insertion of the desired gene. This section may contain sequences that will be cut by specific restriction endonucleases ( cuts within the molecule) 3. Successful insertion of a gene allows the expression of its protein product. This usually provides a specific trait to the "transformed" bacteria. 4. Provides a way to screen a population of bacteria for those that took up the plasmid. For example, if an ampicillin resistance gene is encoded in the plasmid, then only bacteria 10 t4arrow_forward
- Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forwardPlasmid Mapping (what is it? why is it important?).arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning