To argue: Feral cats must be trapped and removed in order to protect plovers. Introduction: Endangered species are organisms that are about to extinct. Piping plovers are tiny shore bird. They are considered as the threatened species due to the habitat loss, increased predator population, decreased food availability and other disturbances. Some predatory animals such as cats, gulls and fox are the important limiting factors of plovers. The plans for the protection of endangered animals are established by the U.S. Fish and Wildlife Service (USFWS).

Question

There are six species of animals in an area at the end of Thunder Bay. The area is wooded land covering rolling hills with two small rivers. Most of the area is surrounded by farm land where people have sheep and cows. There are three roads in the area, one of which leads to an expanding subdivision. a) Chose the species you believe to be most likely to become endangered and the species you believe to be least likely to become endangered. Compare and contrast these two species to explain your decision b) Which two species do you think would be most likely to exhibit a competitive relationship? c) Explain two density-dependent factors that may affect population P in this area d) Explain two density-independent factors that may affect population P in this area

Answer 1

Question

Chapter 44, Problem 1CT

Summary Introduction

To argue:

Feral cats must be trapped and removed in order to protect plovers.

Introduction:

Endangered species are organisms that are about to extinct.

Piping plovers are tiny shore bird. They are considered as the threatened species due to the habitat loss, increased predator population, decreased food availability and other disturbances. Some predatory animals such as cats, gulls and fox are the important limiting factors of plovers.

The plans for the protection of endangered animals are established by the U.S. Fish and Wildlife Service (USFWS).

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

There are six species of animals in an area at the end of Thunder Bay. The area is wooded land covering rolling hills with two small rivers. Most of the area is surrounded by farm land where people have sheep and cows. There are three roads in the area, one of which leads to an expanding subdivision. a) Chose the species you believe to be most likely to become endangered and the species you believe to be least likely to become endangered. Compare and contrast these two species to explain your decision b) Which two species do you think would be most likely to exhibit a competitive relationship? c) Explain two density-dependent factors that may affect population P in this area d) Explain two density-independent factors that may affect population P in this area

By 1935, hunting and trapping had eliminated wolves from the United States, except for Alaska. Wolves have since been protected as an endangered species, they have moved south from Canada and become reestablished in the Rocky Mountains and northern Great Lakes region. Conservationists who would like to speed up wolf recovery have reintroduced wolves into Yellowstone National Park. Local ranchers are opposed to bringing back the wolves because they fear predation on their cattle and sheep. What are some reasons for reestablishing wolves in Yellowstone National Park? What effects might the reintroduction of wolves have on the biological communities in the region? What might be done to mitigate the conflicts between ranchers and wolves?

Hunting is banned in all national parks but not outside of them. During bear hunting season, conservation officers conduct routine checks. One day, the OPP receive a report from campers that they heard shots fired inside Algonquin National Park. The OPP transmits this information to the Natural Resources office. Based on the campers' tip, check points are set up on the highway through Huntsville. All of the hunters that bring bears past the checkpoint have licenses, but in order to check out the camper's story several hairs are pulled from each carcass for DNA checks. The data below shows DNA containing two STR regions for the bear carcasses that were examined on the day after the campers' complaint, and two known reference samples of bear sub-populations around Huntsville, including inside the park. POSSIBLE POACHER'S DNA DATA Reference #1: Genotype Indigenous to Park TCAGGGACGACGACGACGACGACGACCCATTATCGGAGTTATTATTAGATCGATCCATTCGGATCGGATAT Reference #2: Genotype Indigenous to Park…