Biochemistry
8th Edition
ISBN: 9781464126109
Author: Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr., Lubert Stryer
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 52P
Interpretation Introduction
Interpretation:
The effect of the salt concentration DNA melting should be determined.
Introduction:
The melting of the DNA is defined as the separation of the two DNA strands. The two strands are joined together by the hydrogen bonding between the base pairs. The melting/ breaking of the hydrogen bond causes the separation of the DNA double helix.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to-
3'5'-to-3' direction. Other helicases have been reported to move in
the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why
you would expect helicases to move in one direction or the other?
True or False. Explain.
A) At no time during protein synthesis does an amino acid make direct
contact with the mRNA being translated.
B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.
please help me with thi question.
What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA?
The options are attached. Multiple answers can be chosen
Chapter 4 Solutions
Biochemistry
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardThis is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?Locate the sugars and phosphates, and describe their location. Adjacent nucleotides are linked by covalent phosphodiester bonds (-O-P-O-) produced by a condensation reaction. What parts of the adjacent nucleotides are linked by phosphodiester bonds?Two nitrogenous bases extending towards the middle of the double helix. Are there any covalent bonds between these bases?If there are no covalent bonds between these bases, what other kinds of bonds might hold the two strands of the double helix together?arrow_forwardQuestion 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forward
- please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forward
- Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardtransformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forwardHow many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forward
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardproteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license