Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3.10, Problem 1CYU
If one of the DNA strands being replicated “reads” CGAATG, what will be the base sequence of the corresponding DNA strand?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF
YOUR ANSWER)
5' ATCGGCTACGITCAC 3'
3'TAGCCGATGCAA GTG 5'
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand?
5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3'
a) Both sides
b) Neither side
c) The right side
d) The left side
If we are given this segment of DNA:
TTGGHTGUTGG
HHUUTHUGHUU
Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated two times? (note Hypoxanthine pairs with cytosine) and so there would be four sets?
Chapter 3 Solutions
Anatomy & Physiology (6th Edition)
Ch. 3.1 - Summarize the four key points of the cell theory.Ch. 3.1 - How would you explain the meaning of a generalized...Ch. 3.2 - What basic structure do all cellular membranes...Ch. 3.2 - What is the importance of the glycocalyx in cell...Ch. 3.2 - Prob. 3CYUCh. 3.2 - Phospholipid tails can be saturated or unsaturated...Ch. 3.3 - What is the energy source for all types of...Ch. 3.3 - What determines the direction of any diffusion...Ch. 3.3 - What are the two types of facilitated diffusion...Ch. 3.4 - What happens when the Na+-K+ pump is...
Ch. 3.4 - As a cell grows, its plasma membrane expands. Does...Ch. 3.4 - Prob. 3CYUCh. 3.4 - Which vesicular transport process allows a cell to...Ch. 3.5 - What process establishes the resting membrane...Ch. 3.5 - Is the inside of the plasma membrane negative or...Ch. 3.6 - What term is used to indicate signaling chemicals...Ch. 3.7 - Which organelle is the major site of ATP...Ch. 3.7 - What are three organelles involved in protein...Ch. 3.7 - Compare the functions of lysosomes and...Ch. 3.7 - How are microtubules and microfilaments related...Ch. 3.7 - Prob. 21CYUCh. 3.8 - Prob. 22CYUCh. 3.9 - If a cell ejects or loses its nucleus, what is its...Ch. 3.9 - What is the role of nucleoli?Ch. 3.9 - What is the role of nucleoli?Ch. 3.10 - If one of the DNA strands being replicated reads...Ch. 3.10 - During what phase of the cell cycle is DNA...Ch. 3.10 - What are three events occurring in prophase that...Ch. 3.11 - Codons and anticodons are both three-base...Ch. 3.11 - How do the A, P, and E ribosomal sites differ...Ch. 3.11 - What is the role of DNA in transcription?Ch. 3.12 - What is the importance of ubiquitin in the life of...Ch. 3.12 - Prob. 2CYUCh. 3 - The smallest unit capable of life by itself is (a)...Ch. 3 - Prob. 2MCCh. 3 - Prob. 3MCCh. 3 - The term used to describe the type of solution in...Ch. 3 - Osmosis always involves (a) a selectively...Ch. 3 - Prob. 6MCCh. 3 - Prob. 7MCCh. 3 - The endocytotic process in which a sampling of...Ch. 3 - Prob. 9MCCh. 3 - The nuclear substance composed of histone proteins...Ch. 3 - The information sequence that determines the...Ch. 3 - Mutations may be caused by (a) X rays, (b) certain...Ch. 3 - The phase of mitosis during which centrioles each...Ch. 3 - Final preparations for cell division are made...Ch. 3 - The RNA synthesized on one of the DNA strands is...Ch. 3 - The RNA species that travels from the nucleus to...Ch. 3 - If DNA has a sequence of AAA, then a segment of...Ch. 3 - A nerve cell and a lymphocyte are presumed to...Ch. 3 - Prob. 19MCCh. 3 - Explain why mitosis can be thought of as cellular...Ch. 3 - Contrast the roles of ER-bound ribosomes with...Ch. 3 - Cells lining the trachea have whiplike motile...Ch. 3 - Name the three phases of interphase and describe...Ch. 3 - Comment on the role of the sodium-potassium pump...Ch. 3 - Differentiate between primary and secondary active...Ch. 3 - Cell division typically yields two daughter cells,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The E. coli chromosome is 1.28 mm long. Under optimal conditions, thechromosome is replicated in 40 minutes.(a) What is the distance traversed by one replication fork in 1 minute?(b) If replicating DNA is in the B form (10.4 base pairs per turn), how manynucleotides are incorporated in 1 minute in one replication fork?(c) If cultured human cells (such as HeLa cells) replicate 1.2 m of DNAduring a five-hour S phase and at a rate of fork movement one-tenthof that seen in E. coli, how many origins of replication must the cellscontain?(d) What is the average distance, in kilobase pairs, between these origins?arrow_forwardAs shown, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated.arrow_forwardThe E. coli chromosome is 1.28 mm long. Under optimal conditions the chromosome is replicated in 40 minutes. (a) What is the distance traversed by one replication fork in 1 minute? (b) If replicating DNA is in the B form (10.4 base pairs per turn), how many nucleotides are incorporated in 1 minute in one replica- tion fork? (c) If cultured human cells (such as Hela cells) replicate 1.2 m of DNA during a 5-hour S phase and at a rate of fork movement one- tenth of that seen in E. coli, how many origins of replication must the cells contain? (d) What is the average distance, in kilobase pairs, between these origins?arrow_forward
- Find the complement DNA sequences to the following DNA sequences:Sequence # 1: GATATAGTSequence # 2: GAGGTTCSequence # 3: AACTAGATSequence # 4: CCTATAAGSequence # 5: AACGTGATarrow_forwardThere are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardDescribe the structural features of DNA that enable it to be replicated.arrow_forward
- In the gel electrophoresis: the mutant would just run the same as the open circle DNA if it simply weren't able to close its circle. The mutant contains heavier than the single-stranded DNA because what kind of structure is it forming during replication? Wild-type phage DNA does not ever form a double-strand. What happens under denaturing conditions to that structure that helps explain that lane's smudge?In the sucrose centrifuging: what data from the gel electrophoresis support the conclusion?In the electrophoresis/Southern blot: which end of the DNA is the 1100 bp fragment, which end does the kinase ONLY work on?arrow_forwardwhich step of the polymerase chain reaction takes place at 98 degrees?arrow_forwardWhether the statement "In a replication bubble, the same parental DNA strand serves as the template strand for leading strand synthesis in one replication fork and as the template for lagging-strand synthesis in the other fork" is true or false.arrow_forward
- On the right of the replication fork, which DNA strand (top or bottom) will be the template for Okazaki fragment synthesis? What will be the leading strand DNA sequence from the region 1 (answer with DNA sequence)? The following origin of replication is found on E. coli chromosome. The DNA sequence of region 1 is shown below: Region I (Top strand): 5'....CTGACTGACA...3'. 5 < top ofi bottom Region 1 inarrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardSuppose that E. coli synthesizes DNA at a rate of 100,000 nucleotides per minute and takes 40 minutes to replicate its chromosome. (a) How many base pairs are present in the entire E. coli chromosome? (b) What is the physical length of the chromosome in its helical configuration—that is, what is the circumference of the chromosome if it were opened into a circle?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY