Seeley's Anatomy & Physiology
11th Edition
ISBN: 9781259254963
Author: Jennifer Regan (author), Andrew Russo (author), Rod Seeley (author) Cinnamon Vanputte (author)
Publisher: McGraw Hill Higher Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 25.2, Problem 27AYP
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient molecule?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How important is the length of C-chain in the generation of ATP among the organic nutrients?
How many ATPs will be used in producing 2 sugar molecules?
Why is energy required for nutrient transport? Give an example of a system that transports nutrients and describe what source of energy is used to move the nutrients into the cell.
Why can’t most organisms use the nitrogen gas that is so prevalent in the atmosphere? How do these organisms acquire a usable form of nitrogen?
Chapter 25 Solutions
Seeley's Anatomy & Physiology
Ch. 25.1 - Prob. 1AYPCh. 25.1 - Prob. 2AYPCh. 25.1 - Prob. 3AYPCh. 25.1 - Define kilocalorie. State the number of...Ch. 25.1 - List the five food groups shown in MyPlate. How is...Ch. 25.1 - What are the most common monosaccharides in the...Ch. 25.1 - Give three examples of complex carbohydrates. How...Ch. 25.1 - How does the body use glucose and other...Ch. 25.1 - Prob. 9AYPCh. 25.1 - Prob. 10AYP
Ch. 25.1 - Prob. 11AYPCh. 25.1 - How does the body use triglycerides, cholesterol....Ch. 25.1 - Describe the recommended dietary intake of lipids....Ch. 25.1 - Distinguish between essential and nonessential...Ch. 25.1 - Prob. 15AYPCh. 25.1 - Prob. 16AYPCh. 25.1 - Prob. 17AYPCh. 25.1 - Prob. 18AYPCh. 25.1 - Prob. 19AYPCh. 25.1 - Prob. 20AYPCh. 25.1 - Prob. 21AYPCh. 25.1 - Prob. 22AYPCh. 25.1 - Prob. 23AYPCh. 25.1 - Prob. 24AYPCh. 25.1 - Prob. 25AYPCh. 25.2 - Prob. 26AYPCh. 25.2 - How does the removal of hydrogen atoms from...Ch. 25.3 - Describe the four phases of glycolysis. What are...Ch. 25.3 - Prob. 29AYPCh. 25.3 - Prob. 30AYPCh. 25.3 - Prob. 31AYPCh. 25.3 - Define aerobic respiration, and list its products....Ch. 25.3 - Prob. 33AYPCh. 25.3 - Prob. 34AYPCh. 25.3 - Prob. 35AYPCh. 25.3 - Why is the total number of A produced in aerobic...Ch. 25.3 - Prob. 37AYPCh. 25.4 - Prob. 38AYPCh. 25.4 - Prob. 39AYPCh. 25.5 - Prob. 40AYPCh. 25.5 - Prob. 41AYPCh. 25.6 - Distinguish among the processes of glycogenesis,...Ch. 25.7 - Prob. 43AYPCh. 25.7 - Prob. 44AYPCh. 25.7 - When does the postabsorptive state occur?Ch. 25.7 - Prob. 46AYPCh. 25.8 - Prob. 47AYPCh. 25.8 - Prob. 48AYPCh. 25.8 - Prob. 49AYPCh. 25.8 - Prob. 50AYPCh. 25.8 - Prob. 51AYPCh. 25.9 - Prob. 52AYPCh. 25.9 - Prob. 53AYPCh. 25.9 - Prob. 54AYPCh. 25.9 - Prob. 55AYPCh. 25 - Prob. 1RACCh. 25 - Prob. 2RACCh. 25 - Prob. 3RACCh. 25 - Prob. 4RACCh. 25 - Prob. 5RACCh. 25 - Prob. 6RACCh. 25 - Prob. 7RACCh. 25 - Prob. 8RACCh. 25 - Prob. 9RACCh. 25 - Prob. 10RACCh. 25 - Prob. 11RACCh. 25 - Prob. 12RACCh. 25 - Prob. 13RACCh. 25 - Prob. 14RACCh. 25 - Prob. 15RACCh. 25 - Prob. 16RACCh. 25 - Prob. 1CTCh. 25 - Prob. 2CTCh. 25 - Prob. 3CTCh. 25 - Prob. 4CTCh. 25 - Prob. 5CTCh. 25 - Prob. 6CTCh. 25 - Prob. 7CTCh. 25 - Prob. 8CTCh. 25 - Prob. 9CT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
Review the Chapter Concepts list on page 422. These all center on quantitative inheritance and the study and an...
Essentials of Genetics (9th Edition) - Standalone book
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science
Police Captain Jeffers has suffered a myocardial infarction. a. Explain to his (nonmedically oriented) family w...
Human Physiology: An Integrated Approach (8th Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the six classes of nutrients? Which of those nutrients are Macronutrients? Which if those nutrients are Micronutrients? What are the three energy yielding nutrients? What does it mean, when a nutrient is called “organic”?arrow_forwardNitrogen fixation is the reaction of: conversion of gaseous N2 into a biologically useful form of nitrogen (NH3). conversion of gaseous NH3 into a biologically useful form of nitrogen (N2). reduction of nitrogen to a peptide bond. fixing gaseous N2 into an unreactive form. electron transfer to ATP.arrow_forwardWhat is nitrogen metabolism?arrow_forward
- Why is it beneficial for cells to use ATP rather than energy directly from the bonds of carbohydrates? What are the greatest drawbacks to harnessing energy directly from the bonds of several different compounds?arrow_forwardWhat is the major difference between macronutrients and micronutrients?arrow_forwardThe B-oxidation of the saturated 14-carbon fatty acid myristic acid yields the following NET amount of ATP: O A) 92 OB) 94 OC) 96 O D) 106 E) 108arrow_forward
- One example of a stage 1 reaction in the heterotrophic breakdown of food molecules is: the intramitochondrial digestion of pyruvate into carbon dioxide and water the intramitochondrial digestion of fatty acids into carbon dioxide and water the extracellular digestion of triglycerides into fatty acids and glycerol the intracellular digestion of some amino acids into NH4+ and pyruvate the intracellular digestion of glucose monomers into pyruvatearrow_forwardHow are other organic nutrients, such as fats and proteins, used instead of glucose for energy?arrow_forwardWhich of the following statements about anabolism is false? O As a rule, the anabolic pathway by which an organism makes a substance is the exact reverse of the catabolic pathway. Anabolic reactions "spend" ATP by transferring a phosphate group to another molecule. O Pathways that synthesize larger biomolecules from smaller ones are known as anabolism. Gluconeogenesis is the anabolic pathway by which organisms make glucose from pyruvate.arrow_forward
- What is the amount of ATP yield per one glucose molecule? Is this amount always achieved? If not explain what happens to a cell’s essential metabolites when the requirement for biosynthesis is greater than the cells energy requirement? When the biosynthesis requirement is less than its energy requirement?arrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardWhich of the following accurately describes the energy during the biosynthesis of a fat molecule in plants: O Glucose -> fat molecule O Amino acids -> protein molecule O glucose -> starch molecule chemical energy -> heat and motion chemical energy-> chemical energy light energy -> chemical energyarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Microbial Nutrition and Growth; Author: Scientist Cindy;https://www.youtube.com/watch?v=rK3UkyWjkl8;License: Standard YouTube License, CC-BY