Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23, Problem 50RE
Interpretation Introduction
Interpretation: The mode of action for fluorouracil in cancer chemotherapy is to be suggested.
Concept introduction:
In DNA synthesis, deoxyribonucleosides are produced by the reduction of ribonucleoside diphosphates to deoxyribonucleoside diphosphates.
The reaction that is required to produce the substrate for DNA synthesis is the conversion of uracil to thymine.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Recall What is the basis for the separation of proteins by the following
techniques?
(a) gel-filtration chromatography
(b) affinity chromatography
(c) ion-exchange chromatography
recall What are the structural differences between the peptide hor-mones oxytocin and vasopressin? How do they differ in function
Chapter 23 Solutions
Biochemistry
Ch. 23 - RECALL What kinds of organisms can fix nitrogen?...Ch. 23 - RECALL How is nitrogen fixed (converted from...Ch. 23 - Prob. 3RECh. 23 - Prob. 4RECh. 23 - Prob. 5RECh. 23 - Prob. 6RECh. 23 - Prob. 7RECh. 23 - REFLECT AND APPLY Metabolic cycles are rather...Ch. 23 - RECALL What is the relationship between...Ch. 23 - Prob. 10RE
Ch. 23 - Prob. 11RECh. 23 - Prob. 12RECh. 23 - Prob. 13RECh. 23 - Prob. 14RECh. 23 - Prob. 15RECh. 23 - Prob. 16RECh. 23 - Prob. 17RECh. 23 - Prob. 18RECh. 23 - REFLECT AND APPLY Sulfanilamide and related sulfa...Ch. 23 - Prob. 20RECh. 23 - Prob. 21RECh. 23 - Prob. 22RECh. 23 - Prob. 23RECh. 23 - Prob. 24RECh. 23 - RECALL Describe citrulline and ornithine based on...Ch. 23 - Prob. 26RECh. 23 - Prob. 27RECh. 23 - Prob. 28RECh. 23 - Prob. 29RECh. 23 - Prob. 30RECh. 23 - Prob. 31RECh. 23 - Prob. 32RECh. 23 - Prob. 33RECh. 23 - Prob. 34RECh. 23 - Prob. 35RECh. 23 - Prob. 36RECh. 23 - REFLECT AND APPLY Why is it better, when running a...Ch. 23 - REFLECT AND APPLY Argue logically that the urea...Ch. 23 - BIOCHEMICAL CONNECTIONS How is the importance of...Ch. 23 - Prob. 40RECh. 23 - RECALL What is the structural difference between...Ch. 23 - Prob. 42RECh. 23 - RECALL Does the conversion of IMP to GMP use or...Ch. 23 - RECALL Discuss the role of feedback inhibition in...Ch. 23 - RECALL How many high-energy phosphate bonds must...Ch. 23 - REFLECT AND APPLY Why do most mammals, other than...Ch. 23 - Prob. 47RECh. 23 - RECALL Compare the fates of the products of purine...Ch. 23 - Prob. 49RECh. 23 - Prob. 50RECh. 23 - REFLECT AND APPLY Chemotherapy patients receiving...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- REFLECT AND APPLY Why is it inaccurate to say, Smoking causes cancer?arrow_forwardREFLECT AND APPLY Chemotherapy patients receiving cytotoxic (cell-killing) agents such as FdUMP (the UMP analogue that contains fluorouracil) and methotrexate temporarily go bald. Why does this take place?arrow_forwardREFLECT AND APPLY Explain the relationship between TFIID, TBP, and TAFs.arrow_forward
- REFLECT AND APPLY Outline the methods you would use to pro- duce human growth hormone (a substance used in the treatment of dwarfism) in bacteria.arrow_forwardREFLECT AND APPLY Describe the difference between a tumor suppressor and an oncogene with respect to the actual causes of cancer.arrow_forwardREFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG3' Reverse primer 5'TTCTAAGAAACTGTTAAGG3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC3' Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG3' Reverse primer 5'CGGACCTTCATTGGCAATTCGA3'arrow_forward
- REFLECT AND APPLY Would puromycin be useful for the treatment of a virus infection? Why or why not? Would chloramphenicol be useful?arrow_forwardREFLECT AND APPLY Assume that a scientist claims to have discovered mitochondria in bacteria. Is such a claim likely to prove valid?arrow_forwardREFLECT AND APPLY In the produce department of supermarkets, vegetables and fruits (cucumbers are an example) have been coated with wax for shipping and storage. Suggest a reason why this is done.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY