The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present. 3 ' HO − ATGGGCTCATAGCCGGAGCCCTAACC − GTAGACCACGAATAGCATTAGG − p 5 ' The structure for its product should be determined. Concept Introduction: Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur. 3 ' HO − ATGGGCTCATAGCCGGAGCCCTAACC − GTAGACCACGAATAGCATTAGG − p 5 '

Question

Want to see the full answer?

Answer 1

Question

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 2

Question

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Answer 6

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Answer 7

Chapter 22, Problem 9P

Interpretation Introduction

Interpretation:

The following single-stranded polynucleotide acts as a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase in case additional deoxyribonucleic acid (DNA) is not present.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

The structure for its product should be determined.

Concept Introduction:

Generally, the enzyme deoxyribonucleic acid (DNA) polymerase needs both primer as well as template for the reaction to takes place. But, the below product, which is the single-stranded polynucleotide act a substrate for the enzyme deoxyribonucleic acid (DNA) polymerase and makes the reaction to occur.

3'HO−ATGGGCTCATAGCCGGAGCCCTAACC−

GTAGACCACGAATAGCATTAGG−p5'

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 22 - Prob. 1P Ch. 22 - Prob. 2P Ch. 22 - Prob. 3P Ch. 22 - Prob. 4P Ch. 22 - Prob. 5P Ch. 22 - The E. coli chromosome is 1.28 mm long. Under...Ch. 22 - Prob. 7P Ch. 22 - Prob. 8P Ch. 22 - Prob. 9P Ch. 22 - Prob. 10P

Concept explainers

Videos

Want to see the full answer?

Chapter 22 Solutions