Concept explainers
Consider the following DNA base sequence
- a. What dipeptide is formed from the transcription and translation of this DNA segment?
- b. What dipeptide is formed if a DNA point mutation converts ATA to ATG?
- c. What dipeptide is formed if a DNA point mutation converts ATA to AGA?
- d. What dipeptide is formed if a DNA point mutation converts TTA to TTT?
(a)
Interpretation: The dipeptide that is formed by transcription of the given DNA segment has to be predicted.
Concept introduction: DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine, thymine, guanine and cytosine.
A compound possessing two amino acids joined together by one peptide bond is known as dipeptide. The amino acids present in the dipeptide are linked via peptide linkages.
Answer to Problem 22.137EP
The dipeptide that is formed by transcription of the given DNA segment is
Explanation of Solution
The given DNA base sequence is,
The transcription of the above given DNA sequence forms the new hnRNA segment which is given as,
The amino acid that specifies the first codon,
The amino acid that specifies the second codon,
Thus, the amino acid sequence or dipeptide that is formed by transcription of the given DNA segment is
(b)
Interpretation: The dipeptide that is formed if a point mutation converts
Concept introduction: DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine, thymine, guanine and cytosine.
The process of permanently changing the nucleotide sequence of a genome of any organism is known as mutation. In point mutation, one base is replaced by another base in the given base pair sequence.
Answer to Problem 22.137EP
The dipeptide that is formed if a point mutation converts
Explanation of Solution
The given DNA base sequence is,
If point mutation occurs in the given DNA base sequence and converts
The new codon formed after the base pairing is given as,
The amino acid that specifies the first codon,
The amino acid that specifies the second codon,
Thus, the amino acid sequence or dipeptide that is formed after the point mutation of the given DNA segment is
(c)
Interpretation: The dipeptide that is formed if a point mutation converts
Concept introduction: DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine, thymine, guanine and cytosine.
The process of permanently changing the nucleotide sequence of a genome of any organism is known as mutation. In point mutation, one base is replaced by another base in the given base pair sequence.
Answer to Problem 22.137EP
The dipeptide that is formed if a point mutation converts
Explanation of Solution
The given DNA base sequence is,
If point mutation occurs in the given DNA base sequence and converts
The new codon formed after the base pairing is given as,
The amino acid that specifies the first codon,
The amino acid that specifies the second codon,
Thus, the amino acid sequence or dipeptide that is formed after the point mutation of the given DNA segment is
(d)
Interpretation: The dipeptide that is formed if a point mutation converts
Concept introduction: DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine, thymine, guanine and cytosine.
The process of permanently changing the nucleotide sequence of a genome of any organism is known as mutation. In point mutation, one base is replaced by another base in the given base pair sequence.
Answer to Problem 22.137EP
The dipeptide that is formed if a point mutation converts
Explanation of Solution
The given DNA base sequence is,
If point mutation occurs in the given DNA base sequence and converts
The new codon formed after the base pairing is given as,
The amino acid that specifies the first codon,
The amino acid that specifies the second codon,
Thus, the amino acid sequence or dipeptide that is formed after the point mutation of the given DNA segment is
Want to see more full solutions like this?
Chapter 22 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
- Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwarda. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forward
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forwarda. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forward
- Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.arrow_forward. a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Canyou be sure?arrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forward
- In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?arrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning