Concept explainers
Consider the following mRNA base sequence
- a. What dipeptide is coded for by this mRNA?
- b. What dipeptide is formed if a point mutation converts CAC to AAC?
- c. What dipeptide is formed if a point mutation converts ACC to ACU?
- d. What dipeptide is formed if a point mutation converts CAC to AAC and ACC to ACU?
(a)
Interpretation: The dipeptide that is coded by the given mRNA has to be predicted.
Concept introduction: Ribonucleic acid (RNA) is responsible for the synthesis of the molecules that carry out essential cellular functions.. RNA contains the complementary base pairs. The four complementary bases of RNA are adenine, uracil, guanine and cytosine.
A compound possessing two amino acids joined together by one peptide bond is known as dipeptide. The amino acids present in the dipeptide are linked via peptide linkages.
Answer to Problem 22.136EP
The dipeptide that is coded by the given mRNA is
Explanation of Solution
The given mRNA base sequence is,
The amino acid that specifies the base pair,
The amino acid that specifies the base pair,
Thus, the amino acid sequence or dipeptide for the given mRNA base sequence is
(b)
Interpretation: The dipeptide that is formed if a point mutation converts
Concept introduction: Ribonucleic acid (RNA) is responsible for the synthesis of the molecules that carry out essential cellular functions.. RNA contains the complementary base pairs. The four complementary bases of RNA are adenine, uracil, guanine and cytosine.
The process of permanently changing the nucleotide sequence of a genome of any organism is known as mutation. In point mutation, one base is replaced by another base in the given base pair sequence.
Answer to Problem 22.136EP
The dipeptide that is formed if a point mutation converts
Explanation of Solution
The given mRNA base sequence is,
If point mutation occurs in the given mRNA base sequence and converts
The amino acid that specifies the base pair,
The amino acid that specifies the base pair,
Thus, the amino acid sequence or dipeptide formed after the point mutation is
(c)
Interpretation: The dipeptide that is formed if a point mutation converts
Concept introduction: Ribonucleic acid (RNA) is responsible for the synthesis of the molecules that carry out essential cellular functions.. RNA contains the complementary base pairs. The four complementary bases of RNA are adenine, uracil, guanine and cytosine.
The process of permanently changing the nucleotide sequence of a genome of any organism is known as mutation. In point mutation, one base is replaced by another base in the given base pair sequence.
Answer to Problem 22.136EP
The dipeptide that is formed if a point mutation converts
Explanation of Solution
The given mRNA base sequence is,
If point mutation occurs in the given mRNA base sequence and converts
The amino acid that specifies the base pair,
The amino acid that specifies the base pair,
Thus, the amino acid sequence or dipeptide formed after the point mutation is
(d)
Interpretation: The dipeptide that is formed if a point mutation converts
Concept introduction: Ribonucleic acid (RNA) is responsible for the synthesis of the molecules that carry out essential cellular functions.. RNA contains the complementary base pairs. The four complementary bases of RNA are adenine, uracil, guanine and cytosine.
The process of permanently changing the nucleotide sequence of a genome of any organism is known as mutation. In point mutation, one base is replaced by another base in the given base pair sequence.
Answer to Problem 22.136EP
The dipeptide that is formed if a point mutation converts
Explanation of Solution
The given mRNA base sequence is,
If point mutation occurs in the given mRNA base sequence and converts
The amino acid that specifies the base pair,
The amino acid that specifies the base pair,
Thus, the amino acid sequence or dipeptide formed after the point mutation is
Want to see more full solutions like this?
Chapter 22 Solutions
EBK GENERAL, ORGANIC, AND BIOLOGICAL CH
- Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardWhat potential polypeptides can be produced from the following mRNA sequence? There are more than one answer.. 5’ ...GGAGCUCGUUGUAUU... 3’ a. ser-ser-leu-tyr b. leu-cys-cys-ser-arg c. gly-ala-ser-trp-ile d. gly-ala-arg-cys-ile e. glu-leu-val-val f. You can't translate without a start codon. I know (d) is one of the answer but I'm stuck on how to find the rest. Please help.arrow_forward
- ) A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that changes the sequence to 5'- UGCCAUGGUUAAUAACACAUGAGGCGUGAAC-3'. Translate the original mRNA and the mutated mRNA and explain how insertion mutations can have dramatic effects on proteins. ( Hint; Be sure to find the initiation site).arrow_forwardAnother thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.arrow_forwardConsider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAarrow_forward
- Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that is coded for.5′...GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG...3′arrow_forwardThe figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.arrow_forwardThe following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?arrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education