Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 4TYU
A paleontologist has recovered a bit of tissue from the 400-year old preserved skin of an extinct dodo (a bird). Tocompare a specific region of the DNA from a sample vvith DNA from living birds, which of the following would be most useful for increasing the amount of dodo DNA available for testing?
- (A) SNPanalysis
- (B) Polymerase chain reaction (PCR)
- (C) electroporation
- (D) gel electrophoresis
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the situation: A paleontologist has recovered a tiny bit of organic material fromthe 400-year-old preserved skin of an extinct dodo. She would like to compare DNA from the sample with DNA from living birds.Which of the following would be most useful for increasing theamount of DNA available for testing?
Option a.) restriction fragment analysis
Option b.) polymerase chain reaction
Option c.) electrophoresis
Which of the following statements concerning recombinantDNA technology is false?(a) Thus far, no illnesses in laboratory workers have beentraced to genetic recombinants.(b) Production of large amounts of proteins such as insulinand human growth hormone has been made possible us-ing recombinant DNA technology.(c) Recombinant DNA technology offers specific benefitsto the scientific, medical, and general populations.(d) Mutant strains of bacteria produced by genetic re-combination are often unable to survive in the naturalenvironment.(e) Recombinant DNA technology provides a high degreeof risk to the health of the general populations.
In DNA technology, the term vector can refer to(A) the enzyme that cuts DNA into restrictionfragments.(B) the sticky end of a DNA fragment.(C) a SNP marker.(D) a plasmid used to transfer DNA into a living cell.
Chapter 20 Solutions
Campbell Biology (11th Edition)
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - DNA technology has many medical applications....Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 13TYUCh. 20 - Prob. 14TYUCh. 20 - The water in the Yellowstone National Park hot...
Additional Science Textbook Solutions
Find more solutions based on key concepts
6. How can you use the features found in each chapter?
Human Anatomy & Physiology (2nd Edition)
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (5th Edition)
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
Seeley's Anatomy & Physiology
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
6. How can you use the features found in each chapter?
Human Anatomy & Physiology
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following tools of DNA technology is incorrectlypaired with its use?(A) electrophoresis—separation of DNA fragments(B) DNA ligase—cutting DNA, creating sticky ends of restriction fragments(C) DNA polymerase—polymerase chain reaction to amplifysections of DNA(D) reverse transcriptase—production of cDNA frommRNAarrow_forwardWhich of the following best describes the complete sequence of steps occurring during every cycle of PCR? I-The primers hybridize to the target DNA. II-The mixture is heated to a high temperature to denature the double stranded target DNA. III-Fresh DNA polymerase is added. IV-DNA polymerase extends the primers to make a copy of the target DNA. A) II, I, IV. B) I, III, II, IV. C) III, IV, I, II. D) III, IV, II. E) II, III, IV.arrow_forwardQuantitative PCR differs from regular PCR in that it uses [A] to [B] the amount of [C] in a sample. It cannot quantify [D] unless it is first made into [F]. Match each of the following to its appropriate letter: quantify, cDNA, RNA, DNA or RNA, fluorescence. 1) A 2) B 3) C 4) D 5) E Here are the choices for the questions a) quantify b) RNA c) cDNA d) fluorescence e) DNA or RNAarrow_forward
- (A) After three cycles of PCR, how many DNA molecules are present that correspond precisely to the desired amplification product? (B) What about after 5 cycles. Assume that we started with one molecule in each case, and that the reaction is perfectly efficient.arrow_forward(iii) What are the three (3) main cycles in PCR? (iv) Discuss the processes at each PCR cycle mentioned in Q3 a) (iii).arrow_forwardThe PCR technique uses (a) heat-resistant DNA polymerase (b) reverse transcriptase (c) DNA ligase (d) restriction enzymes (e) b and carrow_forward
- Why is DNA ligase so important in recombinant DNA technology? a.) It causes DNA to make multiple copies of itself. b.) It joins two DNA fragments together. c.) It shapes bacterial DNA into a circular plasmid. d.) It cuts DNA into restriction fragments.arrow_forwardGENETICS The modified "dye terminator method for DNA sequencing represented a major improvement over Sanger's original method because ( among other things) it does NOT require a) a DNA primer b) DNA polymerase c) the use of four separate sequencing reactions for each template d) the use of electrophoresis to separate DNA chains based on size e) the used chemically modified dNTPs f) all of the abovearrow_forwardIn pcr experiment, Does electrophoresis show that only DNA products of the desired size are present? If not, what do you think is the reason?arrow_forward
- Based on the following image: A) Identify the largest DNA fragment in sample 5. Explain your selection. B) Why DNA molecules travel to the positive pole in gel electrophoresis? 1 2 3 4 5 ladder PCR Iragmentsarrow_forward6) In automated DNA sequencing a) Radio labelled DNTPS are used b) Radio labelled ddNTPs are used c) Fluorescently labelled DNTPS are used d) Fluorescently labelled ddNTPs are used 7) Given the following DNA strand of interest: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as the primer for PCR? а) 5 СCTTGTAСТАTG 3' b) 5'TAACACТАТАСТ 3' c) 5' CATAGTACAAGG 3' d) 5' AGTATAGTGTTA 3'arrow_forwardThe PCR reaction contains deoxynucleotide triphosphates (dNTPs) in order to construct new DNA. There are four different dNTPs used in this reaction. Which answer below lists the four different dNTPs used in PCR? A) DNA polymerase, helicase, ligase, topoisomerase B) adenine, guanine, cytosine, thymine C) adenine, guanine,cytosine, uracil D) Alanine, guanine, cytosine, Theron onearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License