Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 2, Problem 3CTQ
Plant cell walk are composed of cellulose, a complex carbohydrate exhibiting a unique bond between its glucose subunits. Provide an explanation for the fact that humans cannot digest fruits and vegetables at an efficient level.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider ten glucose molecules that enter a cell. How many ATP can be generated by the complete catabolism of these into CO2 and H2O? If all ten are first incorporated into glycogen, liberated from glycogen, and then fully catabolized into CO2 and H2O, does the ATP tally increase, decrease or stay the same? Consider that 1 UTP = 1 ATP. Explain. Describe the processes which produce ATP and provide a balanced equation of glucose, CO2, H2O and O2
One example of a stage 2 reaction in the heterotrophic breakdown of food molecules is:
the extracellular digestion of amylopectin into glucose monomers
the intramitochondrial digestion of fatty acids into carbon dioxide and water
the intracellular digestion of glucose monomers into pyruvate
the extracellular digestion of triglycerides into fatty acids and glycerol
the extracellular digestion of polypeptides into amino acids
Identify the three-carbon glycolysis intermediate which can be formed, in the cytoplasm, in one enzymatic step (during deamination of the amino acid alanine)?
pyruvate
fructose-1,6-bisphosphate
fructose
glucose-6-phosphate
glucose
How does the presence of a-bonds versus B-bonds influence the digestibility of glucose polymers by humans?Hint: There are two effects.
Chapter 2 Solutions
Microbiology: A Systems Approach
Ch. 2.1 - Explain the relationship between atoms and...Ch. 2.1 - Prob. 2AYPCh. 2.1 - Prob. 3AYPCh. 2.1 - Prob. 4AYPCh. 2.2 - Prob. 5AYPCh. 2.2 - Provide examples of cell components made from each...Ch. 2.2 - Prob. 7AYPCh. 2.2 - Prob. 8AYPCh. 2.2 - Name the nitrogen bases of DNA and RNA.Ch. 2.2 - Prob. 10AYP
Ch. 2.3 - Recall three characteristics common to all cells.Ch. 2 - The smallest unit of matter with unique...Ch. 2 - The ____ charge of a proton is exactly balanced by...Ch. 2 - Electrons move around the nucleus of an atom in...Ch. 2 - Bonds in which atoms share electrons are defined...Ch. 2 - Prob. 5MCQCh. 2 - Prob. 6MCQCh. 2 - Prob. 7MCQCh. 2 - Prob. 8MCQCh. 2 - DNA is a hereditary molecule that is composed of...Ch. 2 - Prob. 10MCQCh. 2 - Prob. 11TFCh. 2 - Prob. 12TFCh. 2 - Prob. 13TFCh. 2 - Prob. 14TFCh. 2 - Membranes are mainly composed of macromolecules...Ch. 2 - Support or refute the following statement: Double...Ch. 2 - Prob. 2CTQCh. 2 - Plant cell walk are composed of cellulose, a...Ch. 2 - Compare and contrast the kinds of chemical bonding...Ch. 2 - Prob. 5CTQCh. 2 - Prob. 1VCCh. 2 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- One example of a stage 1 reaction in the heterotrophic breakdown of food molecules is: the intramitochondrial digestion of pyruvate into carbon dioxide and water the intramitochondrial digestion of fatty acids into carbon dioxide and water the extracellular digestion of triglycerides into fatty acids and glycerol the intracellular digestion of some amino acids into NH4+ and pyruvate the intracellular digestion of glucose monomers into pyruvatearrow_forwardOne example of a stage 3 reaction in the heterotrophic breakdown of food molecules is: the intramitochondrial digestion of fatty acids into carbon dioxide and water the intracellular digestion of glucose monomers into pyruvate the intracellular digestion of some amino acids into NH4+ and pyruvate the extracellular digestion of polypeptides into amino acids the extracellular digestion of triglycerides into fatty acids and glycerolarrow_forwardThe energy for the production of ATP comes from the breakdown of a glucose molecule via many enzyme-mediated chemical reactions occurring at several distinct stages of cellular respiration. During this time, the chemical energy stored in glucose is continually trans- ferred across these reactions. Which of the following describes the form in which most of the energy from the glucose molecule is stored just before the oxidative phosphorylation stage in aerobic cellular respiration? A B с D acetyl CoA FADH 2 NADH pyruvatearrow_forward
- The break down of sugar occurs in biological cells. It goes through multiple stages to produce energy that cells use. One series of reactions during this process is call the citrus acid cycle. Discuss how you could either speed up or slow down the degradation of glucose through the citrus acid cycle? (Hint: look at the citrus acid cycle and choose one step)arrow_forwardGlucose is phosphorylated to glucose-6-phosphate by hexokinase in the first step of the glycolytic pathway to trap it in the cell, as G6P cannot diffuse across the lipid bilayer. This reaction also decreases the concentration of free glucose, favoring additional import of the molecule. However, this has a postive standard free energy of 3 kcal per mole. To favor this reaction, hydrolysis of ATP is coupled, which has a standard free energy of -7 kcal per mole. Determine the actual free energy change in kcal/mole for the following conditions: Glucose concentration: 4.5 mM ATP conc: 3.79 mM G6P conc. 0.052 mM ADP conc: 0.12 mM inorganic phosphate conc: 1.3 mM temperature: 313 K Ans. in 3 SFs.arrow_forwardWhy does the lack of glucose 6-phosphatase activity in the brain and muscle make good physiological sense? Glucose 6-phosphatase allows cells to trap glucose in the cell; however, these tissues primarily rely on noncarbohydrate energy sources. Glucose 6-phosphatase allows cells to generate glucose through gluconeogenesis; however, gluconeogenesis only takes place in the liver. Glucose 6-phosphatase allows cells to release glucose into the blood; however, these tissues should never release glucose. Glucose 6-phosphatase provides glucose 6-phosphate for glycogen synthesis; however, these tissues do not need glycogen.arrow_forward
- Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a malonate attached to the malonyl transferase (MTase) site in an animal fatty acid synthase (FAS) enzyme complex, draw the next reactions/events that result in the extension and processing of the fatty acid by two more carbons to make the saturated 6-carbon fatty acid.arrow_forwardWhenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?arrow_forwardCreate a diagram showing the process of how to make Salivary Amylase. the diagram can be generic to the making of any protein, starting with the DNA in the nucleus and ending with the exocytosis of the Salivary Amylase out of the cells in your salivary glands NOT GRADEDarrow_forward
- True or false - metabolism of triglycerides generate water - sphingolipids are formed from glycerol and fatty acids - unsaturated fatty acids tend to have links in their structure due to double bonds - lateral diffusion of lipids on a bilayer is very slow compared to transverse diffusion - long chain fatty acids would make good components for the waxy coating of plants because their melting temperatures are relatively higharrow_forwarda Imagine that creatine phosphate, rather than ATP, is the universal energy carrier molecule in the human body. Assume that the cellular concentrations of creatine phosphate, creatine, and phosphate are 21.6 mM, 2.16x10-3 mm, and 3.80 mM, respectively. Calculate the weight of creatine phosphate that would need to be consumed each day by a typical adult human if creatine phosphate could not be recycled. (Estimate the free energy of hydrolysis of creatine phosphate under cellular conditions to determine how many moles required. Use the standard free energy AG = -43.3 kJ/mol, and take the temperature to be 37 °C.) AG= kJ/mol Weight of creatine phosphate consumed = 9arrow_forwardPlease make a diagram showing the process of how to make amylase. The diagram can be to the making of any protein, starting with the dna in the nucleus and ending with the exocytosis of the salivary amylase out of the cells in the salivary glands. Please show work and pictures. Thank you.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Nutrition and Diet - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=SFE1DfAlipo;License: Standard Youtube License