Prescott's Microbiology
11th Edition
ISBN: 9781260409062
Author: WILLEY, Joanne
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 17.3, Problem 1MI
Why are long fragments (e.g., 20,000 bp) of genomic DNA often desired when constructing a genomic library?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
Approximately what portion of the human genome is composed of repeat sequences?
What are cis acting DNA sequences? List them
Chapter 17 Solutions
Prescott's Microbiology
Ch. 17.1 - Examine the uncut piece of DNA shown in the upper...Ch. 17.1 - Which of the above enzymes yield blunt ends? Which...Ch. 17.1 - Prob. 3MICh. 17.1 - What would you conclude if you obtained only blue...Ch. 17.1 - Why must introns be removed from eukaryotic DNA...Ch. 17.1 - Which plasmid is a shuttle vector? Why?Ch. 17.1 - In what ways does the BAC shown here differ from...Ch. 17.1 - Describe restriction enzymes, sticky ends, and...Ch. 17.1 - What is cDNA? Why is it necessary to generate cDNA...Ch. 17.1 - Prob. 3CC
Ch. 17.1 - Prob. 4CCCh. 17.1 - Prob. 5CCCh. 17.2 - Why, after three cycles, are the vast majority of...Ch. 17.2 - Briefly describe the polymerase chain reaction....Ch. 17.2 - Why is PCR used to detect infectious agents that...Ch. 17.2 - How would you use PCR to measure the concentration...Ch. 17.2 - Why is it possible to visualize a PCR product on...Ch. 17.2 - Prob. 5CCCh. 17.3 - Why are long fragments (e.g., 20,000 bp) of...Ch. 17.4 - What special considerations are necessary if one...Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - You are studying chemotaxis proteins in a newly...Ch. 17.5 - Prob. 1MICh. 17.5 - Prob. 1CCCh. 17.5 - Prob. 2CCCh. 17 - Which of the DNA molecules shown are recombinant?Ch. 17 - Prob. 1RCCh. 17 - Prob. 2RCCh. 17 - Prob. 3RCCh. 17 - Prob. 4RCCh. 17 - Prob. 5RCCh. 17 - Prob. 6RCCh. 17 - Prob. 1ALCh. 17 - Prob. 2ALCh. 17 - Suppose you transformed a plasmid vector carrying...Ch. 17 - You are interested in the activity and regulation...Ch. 17 - Prob. 5ALCh. 17 - Prob. 6ALCh. 17 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?arrow_forwardExplain why the overlap between individual DNA sequences is required to reconstruct the sequence of a genome.arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forward
- If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?arrow_forwardIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forwardWith a few exceptions, interspersed repetitive DNA in the human genome has no known biological function. Explain in a few sentences what interspersed means. Name and describe one interspersed repetitive element. Provide information on about how much of the human genome consists of this one repetitive element (copy number and/or percent of genome).arrow_forwardWhy is the term “proteome” ambiguous, whereas the term“genome” is not?arrow_forward
- What provides a convenient bridge between the low resolution of a karyotype and the ultra-high resolution of a complete genomic sequence?arrow_forwardThe following DNA sequences were used to generate a contig from a genome sequencing project. ttcagattttccccg gctaaagctccgaa gccattaacgcc tttagcatactacggcgtta aaaaccggggaaaat tccgaatcggtcattcaga How long is the fully assembled contig?arrow_forwardDescribe the characteristics of highly repetitive DNA sequences.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Serology 101: Testing for IgG and IgM antibodies; Author: Beckman Coulter Dx;https://www.youtube.com/watch?v=LtqKB-qpJrs;License: Standard youtube license