Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 10TYU
EVOLUTION CONNECTION Some bacteria may be able to respond to environmental stress by increasjng the rate at which mutations occur during cell division. How might this be accomplished? Might there be an evolutionary advantage to this ability? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Genes participating in informational processessuch as replication, transcription, and translation aretransferred between species much less often than aregenes involved in metabolism. The basis for this inequalityis unclear at present, but one suggestion is that it relatesto the underlying complexity of the two types of processes.Informational processes tend to involve large aggregatesof different gene products, whereas metabolic reactionsare usually catalyzed by enzymes composed of a singleprotein. Why would the complexity of the underlying pro-cess—informational or metabolic—have any effect on therate of horizontal gene transfer?
Proteins like channels embedded within the cell's plasma membrane and enzymes scattered in the cytoplasm carry out vital functions. Can you explain the steps of the biological process, allowing cells to make proteins from genes? Can you please provide as many details to each step?
. While perusing the E. coli K12 genome sequence,you come across a gene with no known function. Theamino acid sequence of the gene’s protein productshows weak similarities with known porins, proteinsthat cross a cellular membrane to let molecules suchas amino acid or sugar nutrients (or drugs like penicillin) pass through. Some porins are nonspecific and letany solute up to a certain size transit into the cell.Other porins are specific and allow the transit ofcertain sugars but not others. What genetic experiments could you do to try to determine whether thisnew gene has a specific function in allowing bacterialcells to scavenge the sugar maltose from the environment? Describe scenarios that might complicate yourexperimental approach.
Chapter 16 Solutions
Campbell Biology (11th Edition)
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - What two properties, one structural and one...Ch. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Describe the levels of chromatin packing you'd...Ch. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - The elongation of the leading Strand during DNA...Ch. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - SCIENTIFIC INQUIRY DRAW IT Model building can be...Ch. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Describe Mendels conclusions about how traits are passed from generation to generation.
Concepts of Genetics (12th Edition)
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
MARINE BIOLOGY
The term ‘spore’.
Biology Science Notebook
The pedigrees indicated here were obtained with three unrelated families whose members express the same disease...
Genetics: From Genes to Genomes
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the: Mutation of the template gene such that an ACC was converted to ATC. Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?arrow_forwardYou have isolated a strain of mutant yeast cells that divide normally at 25 degrees Celsius but cannot ente4 M phase at 37 degrees Celsius. You found that the gene for M cdk is not mutated. Which of the following temperatures sensitive mutations could be responsible for the.behavior of this strain of yeast? Inactivated of an enzyme that normally degrades m cyclin; Inactivated of a protein that normally triggers the synthesis of m cyclin; Inactivated of a protein kinase that normally Inactivate the cdk; none 2. Which of the following statements about the anaphase promoting complex is false? It promotes the degradation of proteins that activates mitosis; it inhibits m cdk activities; it becomes active at the very beginning of metaphase; it is activated by m cdk 3. During cancer development:.? Cells accumulate mutations in a fixed order which results in increase rate of cell division; the inheritance of mutations caused by dna damage is essential for cancer progression; there is typically…arrow_forwardClassifiation of Llfe A new organism was discovered in a deep sea vent at the bottom of the ocean. The researchers collected the sample and made careful observations of it. The picture at right shows a microscopic image captured at 1000X its actual size. Below are some other observations made: • When DNA was isolated from the cell, it was mixed with an equal portion of histone proteins • There are no visible organelles present inside the cell • The specimen seem to die in the presence of oxygen • Able to live in conditions that mimic deep sea vents without any external food source provided Based on these observations, determine each of the following and provide a clear rationale. A) To which domain would you assign this organism? Why? B) Propose a hypothesis of how they obtain nutrients. Are these most likely autotrophs or heterotrophs? Provide a rationale.arrow_forward
- Aa v A A nt Paragraph Styles Nocodazole is a potent inhibitor of microtubule polymerization, which is required for formation of the mitotic spindle. By treating a population of mammalian cells with nocodazole for a time and then washing it out of the medium, we can synchronize the cell population. In the presence of nocodazole, where in the cell cycle do you expect the cells to accumulate? What mechanism do you think is responsible for stopping cell-cycle progression when cells are treated with nocodazole? D Focus COUarrow_forward- - da a Lenuar UVIUI IS UIE UI Ue processes that support the Cell theory. Consider Figure 1 as eukaryotic cell and to be referred in this question. Figure 1 a) Based on Figure 1, does the cell represent a gamete cell? Justify your answer. b) State the value of 2n in Figure 1. c) Using a labelled diagram, ilustrates the cell in Figure 1 after t undergoes S stage. d) If cell in Figure 1 experienced a non-disjunction event on its largest chromosomes during meiosis 2, illustrates the probable gametes it produces using a labelled diagram. e) Give the probabity percentage for each type of gamete produced in 2d). f) Does cell division in E col and in human cells serves the same purpose? Justify your answer.arrow_forwardExplain why they qualify as machines based on their functions and component molecules.arrow_forward
- E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower? GTGCATCTGACTCCTGAGGAGAAG САCGTAGAСTGAGGACTССТСТТС ... ... DNA ... ... (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA •.. ... (translation) VHLT PE K protein ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a UPPER b. LOWERarrow_forwardi need help finding the specfic location for all of thesearrow_forward2) Main component of the cell walls in plants: in fungi: bacteria: 3) What are the double-membrane bounded organelles in a cell? 4) A is the whole genetic material of an organism. Which organelles in cell have their own DNA? and Human Genome Project were created with in 1992, and completed in chromosomes and chromosomes beginning (year). 5) After the invention of by structure of biological cells has better understood. Firstly, he made observations on is used for the first time in his work. cells which were dead. The word 6) chromosome abnormalities (Trisomy21) is an example of human chromosomal disorder. Types of are 7) Order phases of cell cycle putting numbers in blue circles. is the longest phase in cell division. cells make up most of your body's tissues and organs, including skin, muscles, lungs, gut, and hair cells divide by 8) A- For each number, write their names on the right. B- Label the figure below similarly (fill in boxes). BBIX 1- 2- 3- 1 3 4 4-arrow_forward
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardMutations in genes that change their pattern of expression (the time and cell type in which the gene productis produced) are thought to be a major factor in the evolution of different organisms. Would you expect thesame protein to work in the same way (for example, toperform the same kind of enzymatic reaction) in twodifferent types of cells (for example, cells in the retinaof the eye and muscle cells)? Is it possible that the sameprotein might function in different biochemical pathways in eye cells and muscle cells even if the protein’sbasic mechanism always remains the same?arrow_forwardMicrotubules in an animal cell: O a. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to vinblastine O b. undergo disassembly if the concentration of GDP-bound tubulin dimers is high and a cell is exposed to taxol O c. undergo disassembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine O d. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicinearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License