Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 14, Problem 1NST
Summary Introduction
To determine: The inference from the given experiment.
Introduction: In 1962, F. Chapeville and others reported an experiment in which they isolated radioactive C14-cysteinyl-tRNACys. They further removed the sulfur group from the cysteine and created alanyl-tRNACys. When alanyl-tRNACys was added to a synthetic mRNA, a polypeptide chain was synthesized containing alanine.
Expert Solution & Answer
Explanation of Solution
As per the given information, a polypeptide chain was synthesized containing alanine. This occurred after adding radioactively labeled alanyl-tRNACys to a synthetic mRNA. From the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.
Conclusion
Thus, from the given experiment, one can conclude that the amino acid is not involved in recognition of the codon.
Want to see more full solutions like this?
Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
You isolate an E. coli strain in which a mutation in the gene encoding the tRNAAla synthetase
enzyme causes it to charge both tRNAAla and tRNACyS TRNAS with Alanine (Ala).
You sequence the N-terminus of a protein, which normally has the sequence:
Met-Cys-Ala-Thr-Tyr--
Which sequence(s) do you expect to obtain?
Select one:
O Met-Cys-Ala-Thr-Tyr----
O Met-Cys-Cys-Thr-Tyr----
O Met-Ala-Ala-Thr-Tyr----
O Met-Cys-Ala-Thr-Tyr---- + Met-Cys-Cys-Thr-Tyr----
O Met-Cys-Ala-Thr-Tyr---- + Met-Ala-Ala-Thr-Tyr----
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Chapter 14 Solutions
Concepts of Genetics (11th Edition)
Ch. 14 - Prob. 1NSTCh. 14 - A series of mutations in the bacterium Salmonella...Ch. 14 - HbS results from the substitution of valine for...Ch. 14 - Prob. 1CSCh. 14 - Prob. 2CSCh. 14 - Prob. 3CSCh. 14 - HOW DO WE KNOW?
In this chapter, we focused on the...Ch. 14 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 14 - Contrast the roles of tRNA and mRNA during...Ch. 14 - Francis Crick proposed the adaptor hypothesis for...
Ch. 14 - During translation, what molecule bears the codon?...Ch. 14 - The chain of eukaryotic hemoglobin is composed of...Ch. 14 - Assuming that each nucleotide in an mRNA is 0.34...Ch. 14 - Summarize the steps involved in charging tRNAs...Ch. 14 - To carry out its role, each transfer RNA requires...Ch. 14 - What are isoaccepting tRNAs? Assuming that there...Ch. 14 - Discuss the potential difficulties of designing a...Ch. 14 - Prob. 12PDQCh. 14 - Prob. 13PDQCh. 14 - Prob. 14PDQCh. 14 - The synthesis of flower pigments is known to be...Ch. 14 - The study of biochemical mutants in organisms such...Ch. 14 - Explain why the one-gene: one-enzyme concept is...Ch. 14 - Why is an alteration of electrophoretic mobility...Ch. 14 - Prob. 19PDQCh. 14 - Prob. 20PDQCh. 14 - Prob. 21PDQCh. 14 - Prob. 22PDQCh. 14 - Prob. 23PDQCh. 14 - Several amino acid substitutions in the and ...Ch. 14 - Prob. 25PDQCh. 14 - Prob. 26PDQCh. 14 - Prob. 27PDQCh. 14 - Define and compare the four levels of protein...Ch. 14 - Prob. 29PDQCh. 14 - How does an enzyme function? Why are enzymes...Ch. 14 - Prob. 31PDQCh. 14 - Three independently assorting genes (A, B, and C)...Ch. 14 - How would the results vary in cross (a) of Problem...Ch. 14 - Deep in a previously unexplored South American...Ch. 14 - Prob. 35ESPCh. 14 - The flow of genetic information from DNA to...Ch. 14 - Prob. 38ESPCh. 14 - Knowing the quaternary structure of proteins,...
Knowledge Booster
Similar questions
- Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra aminoacids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.arrow_forwardShown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forwardSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. If the same experiment had been conducted on bacterial cells, what results would you expect?arrow_forward
- Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normalarrow_forwardSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.arrow_forwardThe genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lysarrow_forward
- A random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a 5:1 molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and ly- sine in a cell-free translation system in the following proportions: 100, 23.4, 20, 3.3, 3.3, and 1.0, respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?arrow_forwardChristian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high concentrations of beta mercaptoethanol (BME). When BME is removed, it restores only approximately 1% of RNase activity. When a very low concentration of BME is added back to RNase, its activity is restored to nearly 100%. Why? a Low concentrations of BME causes disulfide bonds to break, but they randomly reform. b High concentrations of BME disrupt all disulfide bonds, which inactivates the enzyme. At low concentrations all of the disulfide bonds reform and BME acts as a cofactor for the enzyme. c The enzyme is only active when an intermediate number of disulfide bonds exists. which is achieved only at low concentrations of BME. d The low concentration of BME allows the majority of the proteins to adopt their most stable form, which is the active form.arrow_forwardThe following polynucleotide was synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. · AUAUAUAUAUAUAU- .. What polypeptide would you expect to be produced? What information would this give you about the code?arrow_forward
- In HbS, the human hemoglobin found in individuals with sickle-cell anemia, glutamic acid at position 6 in the beta chain is replaced by valine. Q.) Show that one of the glutamic acid codons can be converted to a valine codon by a single substitution mutation (i.e., by changing one letter in one codon).arrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.arrow_forwardA mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type normally produces a tRNA that recognizes the codon 5’ UGC 3’, and is charged with the amino acid Cysteine (Cys) (its notation is tRNA(Cys)). The mutant tRNA is still charged with Cysteine, but the mutation is in its anticodon that now has the sequence 5’- UCA-3’. How will some of the proteins produced in these E. coli cells be different from the proteins produced in the wild type cellsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education