Starting Out with C++: Early Objects (9th Edition)
9th Edition
ISBN: 9780134400242
Author: Tony Gaddis, Judy Walters, Godfrey Muganda
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 14, Problem 10PC
Prefix to Postfix
Write a program that reads prefix expressions and converts them to postfix. Each prefix expression should be entered on a separate line. The program should keep reading prefix expressions and converting them to postfix until a blank line is entered.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
C programming language question
Home Work 2:
It is required from you to write a code in C language to find the average
for any five numbers.
C++ Code:
This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be:
name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5
This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters.
/** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs)
For example, if the sequence is
AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG
and the vector namesSTRs is…
Chapter 14 Solutions
Starting Out with C++: Early Objects (9th Edition)
Ch. 14.1 - What is a recursive functions base case?Ch. 14.1 - What happens if a recursive function does not...Ch. 14.1 - Prob. 14.3CPCh. 14.1 - What is the difference between direct and indirect...Ch. 14 - What type of recursive function do you think would...Ch. 14 - Which repetition approach is less efficient; a...Ch. 14 - When should you choose a recursive algorithm over...Ch. 14 - Prob. 4RQECh. 14 - Prob. 5RQECh. 14 - Prob. 6RQE
Ch. 14 - Predict the Output 7. What is the output of the...Ch. 14 - Soft Skills 8. Programming is communication; the...Ch. 14 - Prob. 1PCCh. 14 - Recursive Conversion Convert the following...Ch. 14 - Prob. 3PCCh. 14 - Recursive Array Sum Write a function that accepts...Ch. 14 - Prob. 5PCCh. 14 - Recursive Member Test Write a recursive Boolean...Ch. 14 - Prob. 7PCCh. 14 - Prob. 8PCCh. 14 - Ackermanns Function Ackermanns function is a...Ch. 14 - Prefix to Postfix Write a program that reads...Ch. 14 - Prob. 11PCCh. 14 - Prob. 12PC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.arrow_forwardC++arrow_forwardIn C programming, write a function that accepts a character argument and returns 1 if the argument is a valid letter(a-z/A-Z), otherwise returns 0.arrow_forward
- C++ assignment Write a C++ program that lets the user guess whether a randomly generated integer would be even or odd. The program randomly generates an inte- ger and divides it by 2. The integer is even if the remainder is 0, otherwise odd. The program prompts the user to enter a guess and reports whether the guess is correct or incorrect.arrow_forwardPython question Application: Python Fragment Formulation (Q1 – Q4) In this group of questions you are asked to produce short pieces of Python code. When you are asked to "write a Python expression" to complete a task, you can either give the expression in one line or break down the task into several lines. The last expression you write must represent the required task. Question 1 (Reduce parentheses) Give an equivalent version of this expression by removing as many redundant parentheses as possible, without expanding the brackets or simplifying. (x**(2**y))+(y*((z+x)**3)) Question 2 (Translate arithmetic concept into Python) You are given a list of numbers, named numbers, containing 3 integers. Write a python expression (one line) that evaluates to True if and only if the product of any two numbers in the given list is greater than the sum of all three numbers. Note: the product of two numbers, x and y is x*y. Question 3 (List/table access) You are given a table,…arrow_forwardC++ Programmingarrow_forward
- Submerging is the phenomenon wherein the pointer vanishes when you move it too quickly.arrow_forwardStrings manipulation in C++ : Write a program to take input two strings and print the string that is smaller in length.arrow_forwardC++ Memory Game Children often play a memory game in which a deck of cards containing matching pairs is used. The cards are shuffled and placed face down on a table. The players take turns and select two cards at a time. If both cards match, they are left face up; otherwise, the cards are placed face down at the same positions. Once the players choose their pair, they can see the board for some time period and attempt to memorize the configuration of cards. They can then use their memory to select the next pair of cards when it is their turn. The game continues until all the cards are face up. Assume that there are two players and to make the game interesting, keep track of how many correct matches each player makes. When all the cards are turned face up, the player with the most matches is the winner. Write a program to play the memory game. Use a two-dimensional array of 4 rows and 4 columns for a deck of 16 cards with 8 matching pairs. You can use numbers 1 to 8 to mark the cards.…arrow_forward
- C++ programmingarrow_forwardJAVA LANGUAGE CODE Postfix Calculator by CodeChum Admin One good implementation of computing infix expressions is to transform them to postfix and then evaluate via the postfix expression. Infix expressions is the common way of writing arithmetic expressions. The binary operator come between them as shown below: 2 * 5 + 9 - 10 / 20 In postfix expressions, the operands come first before the operator: 2 5 * 9 + 10 20 / - A stack can be used to evaluate postfix expressions. The operands are pushed onto the Stack and when an operator is found two operands are popped and the operation is performed and finally the result is pushed back onto the Stack. The final answer will be the lone element of the Stack. Input The first line contains a positive integer n representing the number of postfix expressions. What follows are n postfix expressions themselves. 5 10 20 + 30 15 2 * + 100 20 30 + / 90 20 10 + + 0 / 9 3 - 10 + 2 * Output A single line containing the result of…arrow_forwardchar lastChar(const char *str){ char last; //loop over the string and go uptill end of the string \0 while(*str !='\0'){ str++; // increment pointer last = *str; //store the current character to the last variable } return last; //last character is returned}arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology Ptr
Microsoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,
Programming Logic & Design ComprehensiveComputer ScienceISBN:9781337669405Author:FARRELLPublisher:Cengage
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,
Programming Logic & Design Comprehensive
Computer Science
ISBN:9781337669405
Author:FARRELL
Publisher:Cengage
.2: Function Parameters and Arguments - p5.js Tutorial; Author: The Coding Train;https://www.youtube.com/watch?v=zkc417YapfE;License: Standard Youtube License