Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.6, Problem 1MQ
- During transformation a cell usually incorporates only one or a few fragments of DNA. Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
During transformation a cell usually incorporates only one or afew fragments of DNA. Explain.
What factors could explain a transformation efficiency?
Which DNA repair systems you think might be capable of repairing a situation where T is in one strand and G is in the complementary strand? Explain dramatically.
Chapter 11 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 11.1 - Distinguish between a mutation and a mutant.Ch. 11.1 - Distinguish between screening and selection.Ch. 11.1 - Prob. 3MQCh. 11.1 - Write a one-sentence definition of the term...Ch. 11.2 - Do missense mutations occur in genes encoding...Ch. 11.2 - Why do frameshift mutations generally have more...Ch. 11.2 - Prob. 1CRCh. 11.3 - Why are suppressor tRNA mutations not lethal?Ch. 11.3 - Which class of mutation, missense or nonsense, is...Ch. 11.3 - What is the difference between same-site and...
Ch. 11.4 - Prob. 1MQCh. 11.4 - Prob. 2MQCh. 11.4 - Prob. 1CRCh. 11.5 - Which protein, found in virtually all cells,...Ch. 11.5 - Explain the fate of transferred chromosomal DNA if...Ch. 11.5 - Prob. 3MQCh. 11.5 - What are heteroduplex regions of DNA and what...Ch. 11.6 - During transformation a cell usually incorporates...Ch. 11.6 - In genetic transformation, what is meant by the...Ch. 11.6 - QExplain why recipient cells do not successfully...Ch. 11.7 - Prob. 1MQCh. 11.7 - What is the major difference between generalized...Ch. 11.7 - Why is phage conversion considered beneficial to...Ch. 11.7 - QExplain how a generalized transducing particle...Ch. 11.8 - In conjugation, how are donor and recipient cells...Ch. 11.8 - Explain how rolling circle DNA replication allows...Ch. 11.8 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 11.9 - In conjugation involving the F plasmid of...Ch. 11.9 - Prob. 2MQCh. 11.9 - Prob. 3MQCh. 11.9 - QWhat is a merodiploid and how does an F plasmid...Ch. 11.10 - Why is it usually more difficult to select...Ch. 11.10 - Why do penicillins not kill species of Archaea?Ch. 11.10 - Explain one type of conjugation in Archaea and how...Ch. 11.11 - Prob. 1MQCh. 11.11 - What is the significance of the terminal inverted...Ch. 11.11 - How can transposons be used in bacterial genetics?Ch. 11.11 - Prob. 1CRCh. 11.12 - Why is the CRISPR system considered a prokaryotic...Ch. 11.12 - Prob. 2MQCh. 11.12 - QExplain why incoming DNA recognized by a short...Ch. 11 - A constitutive mutant is a strain that...Ch. 11 - Although a large number of mutagenic chemicals are...Ch. 11 - Why is it difficult in a single experiment to...Ch. 11 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA isolated from an organism can be sheared into fragments of uniform size (∼1000 bp), heated to separate the strands, then cooled to allow complementary strands to reanneal. The renaturation process can be followed over time. Explain why the renaturation of E. coli DNA is a monophasic process, whereas the renaturation of human DNA is biphasic (an initial rapid phase followed by a slower phase).arrow_forwardWhat increases transformation efficiency?arrow_forwardIn producing genetically engineered human insulin in bacteria, why is it important to use the samerestriction enzyme to cut both the human DNA and the bacterial plasmid?arrow_forward
- Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.arrow_forwardAssume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’arrow_forwardGiven the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’arrow_forward
- Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1. 5.2 kb 2. 0.8 kb 3. 1.2 kb 4. 3.8 kb 5. 3.1 kb After gel electrophoresis, what would be the order in which these fragments would be found—the last fragment listed being furthest from the negative pole.arrow_forwardWhich of these two changes is more difficult for DNA repair enzymes to fix correctly? Explain why.arrow_forwardProkaryotic DNA is normally slightly negatively supercoiled, which can lead to "DNA breathing". How or why does supercoiling lead to DNA "breathing"?arrow_forward
- In experiments using polymerase chain reactions (PCR), it is often more difficult to amplifythrough regions of DNA that are high in GC content versus those regions that are either lower inGC content or are AT-rich. Based on your knowledge of DNA structure, explain why.arrow_forwardDuring agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forwardWhy do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license