Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10.6, Problem 1MQ
- During transformation a cell usually incorporates only one or a few fragments of DNA. Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Look at the picture carefully below and imagine inside a cell nucleus.
a) encircle and name the parts where DNA is most accessible and least accessible
b) how nucleosome positioning or spacing can interfere with DNA accessiblity
Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
In apoptosis, a process of programmed cell death, the cell undergoes controlled degradation of cellular components including nuclear DNA
Researchers have noted that if the DNA is isolated from an apoptotic cell, it appears as distinct bands of multiples of approximately 145 bases
in length. Why does this occur?
Multiple Choice
There is a specific DNase that digests DNA every 145 base pairs.
DNA sequences that appear every 145 base pairs allows for easier DNA breakage.
DNA that is wrapped around the histones is not being degraded.
DNA is coated with transcription factors every 145 base pairs.
Chapter 10 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 10.1 - Distinguish between a mutation and a mutant.Ch. 10.1 - Distinguish between screening and selection.Ch. 10.2 - Do missense mutations occur in genes encoding...Ch. 10.2 - Why do frameshift mutations generally have more...Ch. 10.3 - Why does the Ames test measure the rate of...Ch. 10.3 - Which class of mutation, missense or nonsense, is...Ch. 10.4 - Prob. 1MQCh. 10.4 - Prob. 2MQCh. 10.4 - Prob. 3MQCh. 10.5 - Prob. 1MQ
Ch. 10.5 - Prob. 2MQCh. 10.5 - Prob. 3MQCh. 10.6 - During transformation a cell usually incorporates...Ch. 10.6 - Prob. 2MQCh. 10.7 - Prob. 1MQCh. 10.7 - What is the major difference between generalized...Ch. 10.7 - Why is phage conversion considered beneficial to...Ch. 10.8 - In conjugation, how are donor and recipient cells...Ch. 10.8 - Explain how rolling circle DNA replication allows...Ch. 10.8 - Prob. 3MQCh. 10.9 - In conjugation involving the F plasmid of...Ch. 10.9 - Prob. 2MQCh. 10.9 - Prob. 3MQCh. 10.10 - Why is it usually more difficult to select...Ch. 10.10 - Why do penicillins not kill species of Archaea?Ch. 10.11 - Prob. 1MQCh. 10.11 - What is the significance of the terminal inverted...Ch. 10.11 - How can transposons be used in bacterial genetics?Ch. 10.12 - Why is the CRISPR system considered a prokaryotic...Ch. 10.12 - Prob. 2MQCh. 10 - Write a one-sentence definition of the term...Ch. 10 - Prob. 2RQCh. 10 - Prob. 3RQCh. 10 - Prob. 4RQCh. 10 - Prob. 5RQCh. 10 - What are heteroduplex regions of DNA and what...Ch. 10 - QExplain why recipient cells do not successfully...Ch. 10 - QExplain how a generalized transducing particle...Ch. 10 - QWhat is a sex pilus and which cell type, F or F+,...Ch. 10 - Prob. 10RQCh. 10 - Prob. 11RQCh. 10 - Prob. 12RQCh. 10 - QExplain why incoming DNA recognized by a short...Ch. 10 - A constitutive mutant is a strain that...Ch. 10 - Although a large number of mutagenic chemicals are...Ch. 10 - Why is it difficult in a single experiment to...Ch. 10 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Why is it important for DNA to be copied before a cell undergoes mitosis?arrow_forwardBelow is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?arrow_forwardA major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forward
- Each peak in a chromatogram corresponds to: A fluorescent ddNTP which has been released from the DNA fragment resulting in the termination of synthesis A fluorescent dNTP which has been released from the DNA fragment resulting in the termination of synthesis A fluorescent dNTP which has been incorporated into the DNA fragment resulting in the termination of synthesis. A fluorescent ddNTP which has been incorporated into the DNA fragment resulting in the termination of synthesisarrow_forwardWhy do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
- Draw replication forks that show what you would expect to see if a cell were unable to make the following enzymes: DNA Polymerase Helicase Primase Ligasearrow_forwardTelomerase is not active in most human cells. Some cancer biologists have suggested that activation of the telomerase gene would be a requirement for a cell to become cancerous. Explain why this might be the case.arrow_forwardBackground: DNA nucleotides (i.e A, T, G, and C) are naturally found in a paired, or bonded, arrangement (i.e. the double helix) within the nucleus of every cell. This structure makes the process of replication that occurs prior to mitosis and meiosis very reliable. The purpose of DNA, though, is not simply to make copies of itself, but to provide a set of instructions for the synthesis or "construction" of biomolecules, such as proteins. Why is transcription (i.e. the formation of an RNA copy of a given gene) a necessary step in the "construction" process highlighted above? What is the cell looking to ultimately do with this RNA information?arrow_forward
- Explain how cells activate nucleic acids for polymerization. Explain why DNA is stable and why its structure dictates its replication mechanism. Explain why many RNA molecules exhibit tertiary structure, while most DNA molecules do not. Explain how DNA replication occurs from structural and enzymatic perspectives. Develop an understanding of nucleic acid biology outside a natural biological context (such as PCR, etc.)arrow_forwardIf mutations occur in DNA, there are several mechanisms by which a cell can repair the defect. One method that can be used is nucleotide extision repair. All of the following characterize nucleotide excision repair, except: DNA ligase will replace the excised DNA and seal the backbone Enzymes can cleave the damaged region DNA can be opened to form a bubble so proteins can access the damaged DNA Can identify thymine dimersarrow_forwardGive the name of the enzyme that catalyzes each of the following reactions:(a) Makes a DNA strand from a DNA template. (b) Makes a DNA strand from an RNA template. (c) Makes an RNA strand from a DNA templatearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license