Starting Out with C++ from Control Structures to Objects (9th Edition)
Starting Out with C++ from Control Structures to Objects (9th Edition)
9th Edition
ISBN: 9780134498379
Author: Tony Gaddis
Publisher: PEARSON
bartleby

Concept explainers

Expert Solution & Answer
Book Icon
Chapter 10, Problem 37RQE

Explanation of Solution

Use of pointers to pass C-string argument:

In C++, for passing C-string argument the pointers are extremely useful. Each letter is passed through the pointer parameter variable. It will read until the null character, are part of the string.

Example program:

Consider the example that defines a function that uses a pointer to count the number of times a particular letter appears in a C-string is as follows:

//Header files

#include<iostream>

using namespace std;

//function prototype

int count(char*, char c);

// Define Main function

int main()

{

//Declare the constant variable

const int S = 20;

// Declare the variables as char type

char str[S], l;

//Get the input string from the user

cout << "Enter the string: ";

cin.getline(str, S);

//Get the letter from the user

cout << "Enter a letter: ";

cin >> l;

//call the function

cout << "The total number of times the " << ...

Blurred answer
Students have asked these similar questions
pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
int *p; where p is a null pointer when:

Chapter 10 Solutions

Starting Out with C++ from Control Structures to Objects (9th Edition)

Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Write a statement that will convert the integer...Ch. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 17PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Background pattern image
Computer Science
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Text book image
Systems Architecture
Computer Science
ISBN:9781305080195
Author:Stephen D. Burd
Publisher:Cengage Learning