You are making 300 mL of MS-agar medium for plant tissue culture. You need 0.4 mg/LBAP and 0.8 mg/L NAA. What volume of both hormones will you add if the hormone stock solutions are both1 mg/mL?
Q: In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene…
A: Molecular weight of the protein can be calculated by adding the molecular weight of the individual…
Q: Mutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A.…
A: The nucleotide sequence provided corresponds to the XPA gene of humans. This is deduced by doing a…
Q: a) Draw the 5’-monophosphate-2’-deoxyguanosine nucleotide covalently bonded with neighboring DNA…
A: As per the Watson-Crick model of the DNA double helix: DNA is made up of two strands of…
Q: myristic acid (14:0) carbon dioxide and water a. how many moles of ATP produced from 1 round of the…
A: Human cellular membranes contain myristic acid, albeit at much lower concentrations. It is a…
Q: Answer (FMN, FAD), TPP, PLP, and Adenosylcobalamin and methylcobalamin.
A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…
Q: In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate…
A: Enzymes are biological catalysts. They increase the rate of the reaction they catalyze. There are…
Q: Give 10 examples of enzymes that use NAD/ NADH and NADP/ NADPH and their functions.
A: NAD/NADH and NADP/NADPH act as intermediates in several biochemical reactions. NAD+/NADH and…
Q: 1) Which of the following contains all of the information required to target a precursor protein…
A: e. None of the above The correct answer is none of the above. Targeting of a precursor protein from…
Q: Why does casein precipitates upon the addition of acetic acid? Why is milk used as an antidote in…
A: Proteins are primarily composed of one or more polypeptide chains. Every polypeptide chain is a…
Q: Phosphatidate is: O A) a precursor to triacylglycerol synthesis. O B) a phospholipid. OC) indirectly…
A: Phosphatidates are ester phospholipids and belong to the category of phospholipids. Their structure…
Q: Consider the amino acid aspartic acid for this problem. Aspartic acid can be considered a triprotic…
A: Aspartic acid have 3 ionizable groups in it. They are; alpha- carboxyl group alpha-amino group…
Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…
A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…
Q: Cow's milk allergy (CMA) and lactose intolerance both result from dietary exposure to cow's milk and…
A: Proteins are high molecular weight polymers of amino acids that serve diverse functional roles in…
Q: The AG of a reaction is positive. Which is TRUE? The cell cannot catalyze this reaction under any…
A: In a general reaction such as: A + B ⇌ C + D At equilibrium (steady state), the concentration of…
Q: The following are effects. role of glycosylation, EXCEPT molecular recognition in immunologic…
A: Since you have posted multiple questions we will answer the first question for you. Please repost…
Q: describe five physiological effects which are mediated by G proteins
A: G proteins are guanosine binding proteins, which mediate GPCR signaling pathways. There are two…
Q: In isolating and characterizing carbohydrates, choose between starch and cellulose from a plant…
A: Carbohydrates are composed of carbon, hydrogen and oxygen (CH2O) which performs several functions in…
Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…
Q: 6. List four (4) organelle structures that are similar for both plant and animal cells. List the…
A: Cell organelles, or simply Organelles, are subunits present in a cell responsible for carrying out…
Q: What is the difference between high and very high energy bond molecules? Give 2 examples of each.…
A: Higher the bond energy, more unstable that bond is. Hence, upon breaking of that bond, a large…
Q: Calculate the more fraction of HC! hydrochloric water containing 30% HCl and water in a folution…
A: Mole fraction is a fraction of the number of moles of a particular component in a mixture divided by…
Q: how ecstacy affects the brain?
A: 3,4-methylenedioxy-methamphetamine which is commonly known as MDMA or Ecstasy is a syntheic drug. It…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: 2. In the same figure above, identify what is labeled by the letter D. * The 5' carbon The 3' carbon…
A: Ribose is a 5-carbon sugar. To identify the carbons, they are numbered from C1' to C5'. The carbon…
Q: Determine the amount of glucose in the unknown sample by plotting a standard curve of Absorbance at…
A: Here we are conducting an assay to determine the amount of glucose in an unknown sample. For this,…
Q: TPI deficiency is a rare human condition. Patients who lack TPI cannot convert the triose…
A: Glycolysis is the metabolic pathway that converts 1 molecule of glucose to 2 molecules of pyruvate…
Q: Which type of protein is classified by a polypeptide which is arranged in long strands or sheets?…
A: Each and every live cell has proteins. Protoplasm, cell membranes, and nuclear material all include…
Q: why the Shine–Dalgarno sequence is important to prokaryotes？State the bases of prokayotes’ mRNA
A: Shine–Dalgarno sequence is a short stretch of polypurine sequence ( 4 to 9 purine nucleotides) in…
Q: Question 9 I am an alanine residue present in a peptide with defined secondary structure. I have and…
A: Introduction Proteins are the most abundant macromolecule of our body. Amino acids are the building…
Q: Question 1 Signal sequences direct their delivery to different locations in the cell or outside the…
A: The proteins are made of twenty naturally occurring amino acids that are linked via peptide…
Q: A Moving to anothe estion 18 Articular cartilage has little to no self-healing ability. It is…
A: It is also called as hyaline cartilage. It is firm but slightly elastic or flexible cartilage of…
Q: TRUE OR FALSE 1. FMN or FAD is the semiquinone form of FADH2. 2. Coenzymes can be classified based…
A: Enzymes are biological catalysts that catalyse biochemical reactions. Most enzymes are made up of…
Q: 3. Some proteins are membrane bound and have segments (called transmembrane domains) that pass…
A: There are different proteins associated with lipid bilayer and they perform different functions.…
Q: How do enhancers differ from promoters? Enhancers do not bind RNA polymerase. Enhancers include the…
A: Transcription requires an enzyme called RNA polymerase that catalyses the transcription. Prokaryotic…
Q: Draw an approximate titration curve for lysine, given that its pKa(COOH) = 2.18, its pKa(NH3*) =…
A: Amino acid has a typical structure. It has a central Carbon atom called (Cα). To it 4 groups are…
Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: In prokaryotic RNA synthesis the rate of incorporation of nucleotides is constant throughout the…
A: In prokaryotes, RNA synthesis is carried out the enzyme RNA Polymerase. RNA Polymerase read the DNA…
Q: The diffusion rate of four different membrane proteins (A, B, C, and D) was measured using a FRAP…
A: FRAP is short for Fluorescence recovery after photobleaching, is a method used for determining the…
Q: The question stated the standard free energy change not the actual free energy change. You solved…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: Explain the role of carnitine in the energy supply of the myocardium
A: Carnitine plays an important in heart's metabolism. It's responsible for transporting fatty acids,…
Q: Which of the following is NOT a true statement about the diagram below? Intermediate A Pathway…
A: Enzymes are the biocatalysts that mediate the biochemical reactions of metabolic pathways. They have…
Q: 1) Tabulate the differences and/ or similarities of the different kinds of coenzymes and cofactors.…
A: "Since you have asked multiple questions, we will solve the first eight questions subparts for you.…
Q: What is the main source of energy for ATP replenishment for ATP-PC system
A: ATP is produced by either substrate-level phosphorylation or oxidative phosphorylation Hydrolysis of…
Q: Although as a whole, metabolic pathways are thermodynamically favorable, there’s at least one…
A: The Delta G of a reaction can be calculated as follows. Delta G = Delta G0 + RTln(Q) Where R =…
Q: ）picture1: what bond is this between cytosine and ribose？ 2）picture2 ： what bond is that bewteen…
A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…
Q: Qualitative Tests for Carbohydrates: Sugar Solution Glucose Sucrose Lactose COLOR OBSERVED Molisch's…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: The processes that are involved in protein degradation and folding release energy in the form of ATP…
A: Protein degradation is the process in which proteins are hydrolysed and broken down into individual…
Q: Coenzyme A is: A) a form of cellular energy. OB) an anabolic electron carrier. C) a catabolic…
A: Cells convert energy into small, energy-rich molecules such as ATP and nicotinamide adenine…
Q: 1)s. Name an enzyme that requires NAD/NADH for activity. Draw the chemistry of this reaction (show…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Give one example of a disease related to heart and briefly explain the molecular basis of the…
A: The human body, just like any other complex lifeform (or even simple lifeforms ) functions as a…
Recall the equation of dilution: C1 x V1 = C2 x V2
Where,
- C1 is the concentration of the stock solution.
- C2 is the desired concentration
- V1 is the volume of stock solution.
- V2 is the desired volume
Step by step
Solved in 2 steps
- You have an order for 1 gram of Cefazolin in D5W 100 ml. You have added 5 ml of sterile water to the 1 gram vial to reconstitute powder. However the recommended manufacturer’s diluent amount is 10 ml of sterile water for a final concentration of 100 mg/ml. How would reconstituting the vial with 5 mls affect the concentration and the final calculated dose?During a mass spectrometry experiment, the spectrum of vascular endothelial growth factor A (VEGF-A) was acquired. The absolute error of VEGF-A, having a mass of 1024.5210 Da was 0.06 Da. Calculate the relative error (ppm).Figure 1: Concentration of water samples used to determine urine glucose levels in diamond tetras (Moenkhausia pittieri), with and without exposure to 0.5 I.U./mL insulin. Aquarium water samples were collected at room temperature at 0, 30, 60, and 90 minutes. Concentration values were calculated by obtaining the absorbance (570 nm) of the water samples using a spectrophotometer and compared to a standard curve for glucose to extrapolate the concentration of each sample. Concentration values are plotted with error bars that represent the standard deviation of the concentration levels. 1) how would you describe the trends of this graph in a paragraph asap please
- Nicotiana tabacum cells are cultured to produce a polysaccharide gum. The reactor used is a stirred-tank reactor with an initial volume of 100 L. The maximum specific rate of growth of the culture is 0.18 d-1 and the yield coefficient of substrate in biomass is 0.5 gX/gS. The concentration of the limiting substrate in the medium is 3% (m/v). The reactor is inoculated with 1.5 g/L of cells and operated in batch until the substrate is exhausted, when the medium is fed with a constant flow rate of 8 L/d. The fed batch occurs in a quasi-steady state condition.a) Estimate the time of the batch step and the concentration of cells reached in this phase, considering exponential cell growth.b) The fed batch phase is carried out for a period of 40 days. What is the final concentration of cells in the reactor?c) The bioreactor is available for the process for 275 days a year, with an interval of 24 hours between each cultivation. What is the most advantageous operating mode for the process…To prepare a vaginal irrigation, a nurse uses 3 tsp of vinegar and 1.5 L of water. a. How many ml of vinegar should she use? b. If she prepares a solution using only 500 ml of water, how many ml of vinegar should she use?Your pharmacy has on hand Tetracycline 250 mg/5 mL liquid.You receive a prescription for Tetracycline syrup 500 mg qid for 7 days. How many total milliliters would you dispense? Your pharmacy has on hand Prednisone 5 mg tablets.You receive a prescription for Prednisone 5 mg ii tabs stat and qid x 1 day, then ii tabs tid x 2 days, then ii tabs bid x 2 days, then i tab tid x 3 days, then i tab bid x 3days, then i tab qd x 4 days How many tablets would you dispense for this prescription? How many days will the patient take this medication for? Your pharmacy has on hand Dilantin 100mg capsules.You receive a prescription for Dilantin 100 mg 1 cap po in the AM & PM, 200mg (2 caps) po at noon, and 300mg (3 caps) po at hs. Dispense a 30 day supply. (using the 100mg capsules you have in stock) How many capsules will you dispense? Your pharmacy has on hand Dakins Irrigation Solution 1 liter.You receive a prescription for Dakins Irrigation Solution Irrigate chest tube with 100 mL…
- You will be given 1 mL of a 2.0 mg/mL solution of bovine serum albumin (BSA) and 1 mL of a 2.0 mg/mL solution of bovine gamma globulin (BGG). From these solutions, you will need to make 100 μL of each of the following standards using 1x MBP purification buffer as the diluent for preparation of a standard curve: 1000 μg/mL, 750 μg/mL, 500 μg/mL, 250 μg/mL, 125 μg/mL, and 0 μg/mL.Your 67 YO 195lb, 5ft 10in male patient diagnosed with testicular cancer has been prescribed ifosfamide 1200mg/M2/day IV for 5 days. You calculate the BSA using the mosteller method as being 2.09m2. Ifosfamide is available in 60mL vials contianing 3g of drug. a) How many mL will you administer each day?You have an order for heparin 3000 units SC every 12 hours. You have available 5000 units/mL. How many milliliters will you give? Fill in the blanks. Record your answer using one decimal place.
- Determine the concentration of L. monocytogenes enumerated from the apple slice based on the information below. You must draw your serial dilution and show your mathematical calculation. The apple slice (12 g) was first mixed with 108 ml of sterile 0.1% peptone water. After, 1 ml was added to tube containing 9 ml of sterile 0.1% peptone water. Process was repeated with two additional tubes. 1 ml was pipetted from tubes 2 and 3 onto MOX media. Plates were incubated at 37 for 48 hours. The pictures below show the plates from tube 2 (left) and tube 3 (right).A vial of Doxorubicin reads 0•5g per vial. Instructions say to reconstitute each 12mg with 2•5ml of NS. How many ml of NS will be needed to reconstitute the vial of the recommended concentration? please show workinga dosage of 1,700mg of cefadroxil is to be delivered to a patient in an IV drip over 75 minutes. It's supplied in a solution that contains 1 gram of the drug in 20cc of solution. The pump used to deliver the drug uses units of cc's per hour. at what rate should it be set?