Q: For each listed phenotype you are to list the correct genotype Straight hair (S) is dominant to cur...
A: It is given that straight hair (S) is dominant to curly hair (s). Also, roundheads (R) are dominant ...
Q: explain why risk assessors use a reference dose to quantify noncarcinogenic toxicity but use a cance...
A:
Q: The ribosome is the target for many important antibiotics. These drugs must discriminate between bac...
A: a) Tetracycline: They inhibit protein synthesis via reversible binding to bacterial 30 S ribosomal s...
Q: What genetic defects result in the disorder xeroderma pigmentosum(XP) in humans? How do these defect...
A: xeroderma pigmentosum is also known as XP. It is an inherited condition. The signs and symptoms of X...
Q: What is this figure showing (overall first)? What is happening at each step? How are the little circ...
A: The neurons are the cells of the nervous system that are responsible for the generation and transmis...
Q: (a) Describe the roles of ATP in the sliding filament mechanism of skeletal muscle contraction (...
A: The sliding filament theory explains muscle contraction by describing how muscle proteins slide past...
Q: Provide two examples of lipids for each section: Impermeable Moderately permeable Permea...
A:
Q: 4. In pea plants, the round shape (R) is dominant over wrinkled shape (r) for seed shape and tall (T...
A: Mendel who proposed principles of mendelian inheritance
Q: Which lobe of the cerebral cortex is the center for impulse control (the brain's "stop sign")? parie...
A: As the nervous system is one of the most important system present in the body;which are able to main...
Q: 4. Tigers, jellyfish and sponges are all apart of this kingdom: a. animalia b. plantae c. fungi d. b...
A: The Five Kingdom Classification is one of the most widely used methods for classifying living organi...
Q: Describe the roles played by carbohydrates in cells: A.) Raw material B.) Structural support C.) Cel...
A: Carbohydrates are a class of biological macro-molecules that are important for day-to-day functions ...
Q: If you were to argue that viruses are living organisms, what features of viral structure and functio...
A: INTRODUCTION Viruses It is a small submicroscopic organism replicate only in a host.
Q: A rare dominant mutation expressed at birth was studiedin humans. Records showed that six cases were...
A: Answer : Since 2 cases were the ones which already had the mutation already present in their parents...
Q: What are the functions of microtubules?
A: A cell organelle is usually defined that they are been stated that they are supposed to be a subcell...
Q: the vapor phase concentration in ppm(v)?
A: Vapour phase concentration is the amount of water vapor present in a unit volume of air, usually exp...
Q: How do we isolate culture media (step by step process) and what is the purpose of bacterial culture ...
A: Introduction :- Microorganisms can be found in the natural environment, such as soil. They coexist w...
Q: Which one of the following features is common to both RNA and DNA? Contain just four types of bases ...
A: DNA and RNA both are nucleotides that contain genetic information of the organism. RNA is produced f...
Q: Directions: Solve these genetic problems. Be sure to complete the Punnett square to show how you der...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: Flow Char
A: The ecosystem on the earth is a cooperative space between the biotic and abiotic factors. All these ...
Q: Describe in detail the formation of unit cells by type (we studied 3 in class) and the development o...
A: Unit cell: In crystal lattice, the smallest unit or the building block is called unit cell.
Q: Jenna is studying biodiversity and the factors that affect it. She learns that many factors influenc...
A: Ecosystem biodiversity refers to the wide range of ecosystems, both in terms of their nature and num...
Q: explain why an increase in plasma viscosity will increase the ESR
A: NOTE- As per Bartleby rules and regulations, we are supposed to answer only for first question. Will...
Q: how mutations can be repaired ?
A: Introduction: When it comes to its base makeup and DNA sequence, the genetic macromolecule known as ...
Q: Compare DNA transposons and retrotransposons. What propertiesdo they share?
A: A transposable element (TE, transposon, or jumping gene) is a DNA sequence that may move about withi...
Q: Addition of meat in the diet which contains heme could increase the absorption of iron from plant so...
A: The essential mineral that is required for the purpose of blood production is referred to as iron. I...
Q: Define about constitutive mutations ?
A: In biology, mutation is the phenomenon in which change in sequence of DNA, alternation in nucleotide...
Q: In polygenic systems, how many phenotypic classes corresponding to number of polygene “doses” are ex...
A: In any population a number of phenotypes may be found. Phenotype is the expressed traits observed in...
Q: When a molecule has a direct effect on DNA, this is called; Tropic effect O Physiological effect O F...
A: Introduction :- The molecule found inside cells that contains the genetic information necessary for ...
Q: HIV what is the genome for the virus? And, what Baltimore class does the virus belong to? does the v...
A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: AIDS...
Q: In one sentence each, how are the following bonds formed and broken in biomolecules? a) ester bond...
A: Introduction A macromolecule, such as a protein, is an extremely big molecule. Polymers of simpler ...
Q: Briefly explain how differences in TWO specific traits make evolution in whales slow and evolution i...
A: The change in genetic material over time is called evolution. Mutations which are the changes in DNA...
Q: Which well-known microbiologist do you think had the greatest influence on microbiology? Why?
A: According to me, i think Louis Pasteur had a great influence on microbiology. He is also considered ...
Q: Draw a typical stress-strain curve of a human long bone. Indicate the physical units. Properly label...
A: Our skeletons' capacity to sustain mobility and give protection to our important organs is dependent...
Q: Predict the replication step for the novel Miovirus. This virus was determined to have a dsRNA genom...
A: Introduction A virus is a small piece of genetic material, such as DNA or RNA, encased in a protein ...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: A medium containing an abundance of substrate was seeded with 20 mg/L VSS of an active mixed culture...
A: Detecting specific genes can be used to screen a collection of isolates and obtain the distribution ...
Q: What are some causes of hypersecretion of hormones? O Tumors O None of these is correct O Atrophy of...
A: Tumors A tumour is a swelling or pathological enlargement caused by an excess of cell growth and div...
Q: Which route of administration has 100% bioavailability? O oral intramuscular
A: The different routes of administration are the ways in which a drug can be administered. The oral ro...
Q: The protein based hormones that cannot enter cells is called; O Steroid hormones O Two of these answ...
A: There are few important terms which should kept in mind before answering the above question: We kno...
Q: Explain in how did Candida intermedia contaminate raw milk?
A: Candida is a yeast genus that is responsible for the majority of fungal infections globally. Numerou...
Q: Define the Regulation of gene expression in bacteria ?
A: All the cells contain genes in them. Genes carry the information on hereditary material. Genes are p...
Q: How might early dog domestication compare with pet dog breeding in the U.S. today? Explain in detail...
A: Early dog domestication- It's found that the earliest dogs in US were not domesticated from local wo...
Q: Define about lactose (lac) operon ?
A: The lactose operon also known as the lac operon is a set of genes that are specific for uptake and m...
Q: embedded
A: The Uteroplacental circulation is the vascular contact that is present between the uterus and the fo...
Q: Describe the methods that are used to transfer ions across the cell membrane
A: The cell membrane are semi permeable and selective permeable. Ions and other molecules which are tra...
Q: What are long terminal repeat (LTR) ?
A: Long terminal repeat are repetitive sequence of DNA found at the end of pro-viral DNA after reverse ...
Q: 4. characterize the physical-chemical properties of environmental contaminants related to their beha...
A: Contaminants are substances that reduce the quality of air, water and land and cause pollution.
Q: In humans, color vision depends on genes encodingthree pigments. The R (red pigment) and G (green pi...
A: Genetics is a part of science that deals with the investigation of genes, genetic variation, and her...
Q: The MAOIS work by inhibiting the reuptake of monoamines.
A: MAO are Monoamine oxidases. They are a family of enzymes that catalyze the oxidation of monoamines....
With the aid of examples, explain fully why some botanical fruits are mistaken to be vegetables.
Step by step
Solved in 2 steps
- What is the description of the flower of the banana (Musa acuminata)? Based on the given text.Are there specific chemicals being applied for the plants to produce seeds? If yes, give some examples and describe each.what is the importance of plant seeds in medicine and pharmacy? write a paragraph explaining it.
- Compare and Contrast Monocot seeds and Dicot seedsWhat is pollination and how is it important to the environment? Please explain the scientific significance of this process. Cite references.What is the difference between a gumamela and banana as depicted by the pictures below? a. gumamela is a monocotyledonous plant; on one hand, banana is a dicotyledonous plant b. Both are monocotyledonous plants c. Gumamela is a dicotyledonous plant; on the other hand, banana is a monocotyledonous plant. d. both are dicotyledonous plants
- How to germinate okra, tomato, bitter gourd and cowpea seeds. Explain briefly in step by step explanation.What is the description of the leaves of the banana (Musa acuminata)? Based on the given text.Answer the following question: What is the difference between a fruit and a vegetable? In what ways does human welfare depend on seed plants?
- Are there specific chemicals being applied for the leafy vegetables to produce seeds? If yes, give some examples and describe each.In an area that is not equipped with irrigation facilities and prone to drought during dry months, give and explain TWO (2) characteristics of plants that could thrive under such conditions.In tabulated form, contrast the family Poaceae from the family Cyperaceae.