TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3' to 5' direction? 3'- -5' 2) What are the first five ribonucleotides of the MRNA transcript of this gene ? 5'- -3

Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
icon
Related questions
Question

Need help on this! If additional information is needed, please ask.

A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons.
5'-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT
АТTGTGCTGACТTTТСТСAGGTGGCCCGTATAGGCТААGCTGCGСАТCGCCGCTAGTCGCTCAGTTCСGC
TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACCGCGCTATGCGCATCGTATGCGAT-3'
1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3' to 5' direction?
3'-
-5'
2) What are the first five ribonucleotides of the MRNA transcript of this gene ?
5'-
-3'
3) What are the first five ribonucleotides following exon 1 in the mature MRNA transcript?
5'-
-3'
4) What is the 5' UTR of the mature MRNA transcript in ribonucleotides?
5'-
-3'
5A) What are the first five ribonucleotides of the 3' UTR?
5'-
-3'
B) What are the last five ribonucleotides of the 3' UTR?
5'-
-3'
6) How many amino acids are in the protein encoded by the mRNA?
amino acids
7) Using a codon chart, translate the mRNA transcript into protein, using the single letter amino acid code and no spaces.
N terminus-
-C terminus
8) The bolded "A" nucleotide near the beginning of line 2 is the adenine in the intron that is responsible for forming the lariat during splicing. It is thus part of the consensus splicing motif.
A) If this is mutated to G, what are the 5 ribonucleotides following exon 1 in the mature MRNA transcript?
5'-
-3'
B) Does this mutation result in a frame shift?
C) How many amino acids are in the protein encoded by the MRNA following this mutation?
amino acids
D) Using a codon chart, translate the MRNA transcript with the mutation described in 8A into protein, using the single letter amino acid code and no spaces.
N terminus-
-C terminus
9) In another mutation from the original wild-type sequence, the bolded G in the middle of the second line is mutated to A.
A)How many amino acids are in the protein encoded by the mRNA?
amino acids
B) Using a codon chart (posted under the Translation module in Moodle), translate the mRNA transcript with the mutation described in 9 into protein, using the single letter amino acid code and no spaces.
N terminus-
-C terminus
Transcribed Image Text:A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5'-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT АТTGTGCTGACТTTТСТСAGGTGGCCCGTATAGGCТААGCTGCGСАТCGCCGCTAGTCGCTCAGTTCСGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACCGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3' to 5' direction? 3'- -5' 2) What are the first five ribonucleotides of the MRNA transcript of this gene ? 5'- -3' 3) What are the first five ribonucleotides following exon 1 in the mature MRNA transcript? 5'- -3' 4) What is the 5' UTR of the mature MRNA transcript in ribonucleotides? 5'- -3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'- -3' B) What are the last five ribonucleotides of the 3' UTR? 5'- -3' 6) How many amino acids are in the protein encoded by the mRNA? amino acids 7) Using a codon chart, translate the mRNA transcript into protein, using the single letter amino acid code and no spaces. N terminus- -C terminus 8) The bolded "A" nucleotide near the beginning of line 2 is the adenine in the intron that is responsible for forming the lariat during splicing. It is thus part of the consensus splicing motif. A) If this is mutated to G, what are the 5 ribonucleotides following exon 1 in the mature MRNA transcript? 5'- -3' B) Does this mutation result in a frame shift? C) How many amino acids are in the protein encoded by the MRNA following this mutation? amino acids D) Using a codon chart, translate the MRNA transcript with the mutation described in 8A into protein, using the single letter amino acid code and no spaces. N terminus- -C terminus 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the second line is mutated to A. A)How many amino acids are in the protein encoded by the mRNA? amino acids B) Using a codon chart (posted under the Translation module in Moodle), translate the mRNA transcript with the mutation described in 9 into protein, using the single letter amino acid code and no spaces. N terminus- -C terminus
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

Blurred answer
Knowledge Booster
Intelligence
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education