Q: 2. On the replication bubble below, draw the newly synthesized strands of DNA as they would be seen…
A: DNA replication occurs at body temperature (37 degrees Celsius in humans) with the assistance of a…
Q: Please assign a phase to numbers 2, 14, and 15 and make conclusions about the length of the other…
A: Please follow step 2 for detailed explanation.
Q: http://www.treeboss.net/tree-trunk-splotches.htm downloaded 21 March 2012 Q12. What do you think it…
A: This activity is about different types of living beings which have different characteristics such as…
Q: Dichotomous Key Homework Use this Dichotomous Key and identify each of these seven leaves. You can…
A: Using the dichotomous key for the given leaves Following things can be concluded: (1):- It is a…
Q: how is the rasberry is related to strawberry, banana and grape in a clade?
A: If fruit is developed from the ovary the fruit is known as the true fruit but sometime some other…
Q: Name an organism that can cause a disease in each of the three systems we have most recently…
A: Introduction:- Disease is a type of disorder that affect the physical, mental and emotional well…
Q: and horns, to a dragon from another true-breeding line with no forelimbs, no wings, and no horns.…
A: During sexual reproduction, during the meiosis phase, the DNA sequences that are near to one another…
Q: You're studying two species of closely related mice. One has a lifespan of 32 weeks, on average; the…
A: Quantitative trait loci (QTL) are genetic areas that frequently result from genetic interactions…
Q: Explain how ALS leads to physiological symptoms
A:
Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…
A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.
Q: What is evolution? What is adaptation?
A: Dear students, as per the QnA guidelines of bartleby, we are not permitted to write essays. I am…
Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…
A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…
Q: A grouping composed of horsetails, ferns, gymnosperms, and angiosperms and their common ancestor is…
A: When a taxon includes all descendants of a single ancestor, then it is referred as monophyletic…
Q: When homozygous yellow mutant rats [J] are crossed with homozygous black mutant rats [N], all F1 is…
A: The answer is B: No genetic interactions here. Two genes are acts independently.
Q: Based on the results depicted above, what do you conclude about your hypothesis? Give specific…
A: Introduction:- The respiration and metabolism in an organism can occur, either in the presence or in…
Q: What is diabetes type 1 and 2 and why does it occur ? and what is the tole of insulin pump for…
A: Insulin is a hormone, which is secreted by the pancreas which regulate the sugar in the body.
Q: Next you take measurements of different long bones to estimate stature. Humerus length = 30.04 cm…
A: Given that: Humerus length = 30.04 cm Femur length = 42.5 cm Tibia length 33.88 cm = Using humerus…
Q: O Cats O Dogs O Elephants O Humans O Spiders (like Charlotte in Charlotte's Web)
A: Semelparity is a type of reproductive technique. It is opposite of iteroparity.
Q: The formation of _______ during ______ occurs in meiosis, and is different from what occurs in…
A: Tetrad : During the zygotene phase of meiotic prophase, tetrads develop. It is an exclusively…
Q: Micropropagation, somatic embryogenesis, and organogenesis are three major in vitro plant…
A: Introduction:- Plant regeneration is defined as the generation of whole plant from a single cell or…
Q: Based on the dental development image from the previous question, this individual is at least _…
A: Eruption of teeth is useful in estimating age. The developmental characteristics of eruption and…
Q: describe the IR spectra pattern of ascorbic acid (Vitamin C)
A: Analysing Infra Red (IR) spectra of any compound provide an idea about their identification through…
Q: You can expect to observe a _______ lower VO2max value on a cycle ergometer compared to a treadmill.
A: introduction VO2 max measures how much oxygen is breathe during exercising depend on your…
Q: Explain why the second time you encounter an organism only your memory cells respond. Is this…
A: During the encounter with antigenic entity second time, there are already many memory cells present…
Q: Using techniques described in this chapter, how could you determine whether Archaea exist in the…
A: Introduction Archaea are single-celled microorganisms that are structurally same as bacteria.…
Q: Which of the following genotypes should be considered "true breeding"? 1.) AaBB 2.) AaBb 3.) aaBB…
A: Genotypes It refers to the set of genes possessed by an organism. It describes the variant forms of…
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: The transportation of fatty acids into the mitochondria for oxidation occurs by...... O Facilitated…
A: The carnitine shuttle, which is made up of the enzymes carnitine-palmitoyltransferase 1,…
Q: Describe 4 ways that your skin protects you from infectious diseases.
A: 1. The skin or epidermis of our body is an intact outer layer of our body. This is not permeable to…
Q: If radioactive guanine is added to the growth medium of cells, which macromolecules will be…
A: There are four nucleotide bases in DNA and RNA. Guanine (G) is one of these bases in DNA and RNA.…
Q: Q2 (a) In 2014, during their iGEM project on biodesalination, students were willing to modify…
A: There are perform a restriction digestion process by restriction endonuclease PstI which recognize…
Q: #1 #2 Lab 11: Osmosis and Diffusion - - Additional Resources Bio 104 - McCabe 3. Explain how this…
A: When an Elodea cell gets placed in a solution of lower concentration (hypotonic) than cytoplasm,…
Q: 1. Differentiate the genotype and phenotype of a cell. 2. If deoxyribonucleotides that lack the…
A: In an organism the genetic matter is present inside the genes present in the chromosome of the…
Q: 6. Explain why a positive test for COVID19 would appear sooner than a negative result when using…
A: While studying the global pandemic it is assumed that approximately 300,000 children or more might…
Q: When will arm span and knee height be used? Are there any limitations on using these two methods?
A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…
Q: Sample 1 Sample 2 Sample 3 Semp Sample 5 Is there DNA evidence to support the arrest of the accused…
A: DNA is unique to an individual. DNA fingerprinting also known as DNA profiling, is a technique of…
Q: A mutation in the gene "tan" in fruit flies results in a lack of pigmentation. The same mutation…
A: The tan gene in insects regulates metabolism and biochemical characteristics. It gives the colour of…
Q: ut the following steps of SARS-CoV-2 replication in order ag and drop options into correct order and…
A: SARS-CoV-2 is a single stranded RNA virus which causes Covid-19. For replication, it has to use host…
Q: This reflects the highest identification of the aligned sequences in the database to the sequence…
A: Aligned sequence refers to the sequence that is matched to the sequence present in the database.…
Q: What is the coefficient of relatedness for second cousins?
A: A measure of how closely two people are related is determined by the coefficient of the…
Q: GCTA A AAG GCG
A: Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed…
Q: Name the specific blood vessels which supply oxygenated blood and collect deoxygenated blood from…
A:
Q: Cancer cells need more DNA synthesis but the NADPH/ NADP* ratio is high. Which of the following…
A: Cancer cells are rapidly growing cells with high energy demand and synthesize more DNA. The high…
Q: The police present you with 4 unsolved missing persons cases from the area where the remains were…
A: In the question it is given to find out that which of the following is a hiker and most likely to be…
Q: Glycolysis occurs in what part of the cell? O eukaryotes: inner membrane of mitochondria;…
A: Question : Glycolysis occurs in what part of the cell ? Answer : Eukaryotes : cytosol ;…
Q: List all of the different methods for fertility control in a foraging, Agricultural and Industrial…
A: Foraging means hunting for food by gathering or scavenging animals. Agricultural means obtaining…
Q: Put the labels to the location of the structure being described.
A: The correctly labelled diagram is shown in step 2.
Q: Explain why a different influenza vaccine is necessary every year. How is this different from the…
A: A type of genetic variation in viruses called antigenic drift results from the accumulation of…
Q: According to the MyPlate recommendations, consumption of "empty calories" (as in soft drinks, sports…
A: A person's lifestyle, which includes nutrition, age, gender, amount of exercise, and other factors,…
Q: DNA polymerase error rates can be 10-8 to 10° per nucleotide, and mutations in the repair functions…
A: DNA polymerase is an enzyme responsible for the replication of DNA. It catalyzes the polymerization…
Step by step
Solved in 2 steps
- Who Owns Your Genome? John Moore, an engineer working on the Alaska oil pipeline, was diagnosed in the mid-1970s with a rare and fatal form of cancer known as hairy cell leukemia. This disease causes overproduction of one type of white blood cell known as a T lymphocyte. Moore went to the UCLA Medical Center for treatment and was examined by Dr. David Golde, who recommended that Moores spleen be removed in an attempt to slow down or stop the cancer. For the next 8 years, John Moore returned to UCLA for checkups. Unknown to Moore, Dr. Golde and his research assistant applied for and received a patent on a cell line and products of that cell line derived from Moores spleen. The cell line, named Mo, produced a protein that stimulates the growth of two types of blood cells that are important in identifying and killing cancer cells. Arrangements were made with Genetics Institute, a small start-up company, and then Sandoz Pharmaceuticals, to develop the cell line and produce the growth-stimulating protein. Moore found out about the cell line and its related patents and filed suit to claim ownership of his cells and asked for a share of the profits derived from the sale of the cells or products from the cells. Eventually, the case went through three courts, and in July 1990n years after the case beganthe California Supreme Court ruled that patients such as John Moore do not have property rights over any cells or tissues removed from their bodies that are used later to develop drugs or other commercial products. This case was the first in the nation to establish a legal precedent for the commercial development and use of human tissue. The National Organ Transplant Act of 1984 prevents the sale of human organs. Current laws allow the sale of human tissues and cells but do not define ownership interests of donors. Questions originally raised in the Moore case remain largely unresolved in laws and public policy. These questions are being raised in many other cases as well. Who owns fetal and adult stem-cell lines established from donors, and who has ownership of and a commercial interest in diagnostic tests developed through cell and tissue donations by affected individuals? Who benefits from new genetic technologies based on molecules, cells, or tissues contributed by patients? Are these financial, medical, and ethical benefits being distributed fairly? What can be done to ensure that risks and benefits are distributed in an equitable manner? Gaps between technology, laws, and public policy developed with the advent of recombinant DNA technology in the 1970s, and in the intervening decades, those gaps have not been closed. These controversies are likely to continue as new developments in technology continue to outpace social consensus about their use. Should the physicians at UCLA have told Mr. Moore that his cells and its products were being commercially developed?Who Owns Your Genome? John Moore, an engineer working on the Alaska oil pipeline, was diagnosed in the mid-1970s with a rare and fatal form of cancer known as hairy cell leukemia. This disease causes overproduction of one type of white blood cell known as a T lymphocyte. Moore went to the UCLA Medical Center for treatment and was examined by Dr. David Golde, who recommended that Moores spleen be removed in an attempt to slow down or stop the cancer. For the next 8 years, John Moore returned to UCLA for checkups. Unknown to Moore, Dr. Golde and his research assistant applied for and received a patent on a cell line and products of that cell line derived from Moores spleen. The cell line, named Mo, produced a protein that stimulates the growth of two types of blood cells that are important in identifying and killing cancer cells. Arrangements were made with Genetics Institute, a small start-up company, and then Sandoz Pharmaceuticals, to develop the cell line and produce the growth-stimulating protein. Moore found out about the cell line and its related patents and filed suit to claim ownership of his cells and asked for a share of the profits derived from the sale of the cells or products from the cells. Eventually, the case went through three courts, and in July 1990n years after the case beganthe California Supreme Court ruled that patients such as John Moore do not have property rights over any cells or tissues removed from their bodies that are used later to develop drugs or other commercial products. This case was the first in the nation to establish a legal precedent for the commercial development and use of human tissue. The National Organ Transplant Act of 1984 prevents the sale of human organs. Current laws allow the sale of human tissues and cells but do not define ownership interests of donors. Questions originally raised in the Moore case remain largely unresolved in laws and public policy. These questions are being raised in many other cases as well. Who owns fetal and adult stem-cell lines established from donors, and who has ownership of and a commercial interest in diagnostic tests developed through cell and tissue donations by affected individuals? Who benefits from new genetic technologies based on molecules, cells, or tissues contributed by patients? Are these financial, medical, and ethical benefits being distributed fairly? What can be done to ensure that risks and benefits are distributed in an equitable manner? Gaps between technology, laws, and public policy developed with the advent of recombinant DNA technology in the 1970s, and in the intervening decades, those gaps have not been closed. These controversies are likely to continue as new developments in technology continue to outpace social consensus about their use. Do you think that donors or patients who provide cells and/or tissues should retain ownership of their body parts or should share in any financial benefits that might derive from their use in research or commercial applications?Transcribing and translating transcribe and translate the following DNA molecules DNA:GCTAGTACGTGCACATTAGAA mRNA: amino acids:
- Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna sequence and type of its mutationGENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'-------------------------------------------------------------------------MUTATED DNA SEQUENCE1. 3' TAC CGC TTA TTA TTA CGT GCT GCT ATC GCT 5'2. 3' TAC CGC TAA TTA TTA CGT GCT GCT ATC GCT 5'Amino acid of each mutated sequence _______________type of mutation of each mutated sequence _______________Why is TP53 called the Guardian of the genome?Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna sequence and type of its mutationGENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'-------------------------------------------------------------------------MUTATED DNA SEQUENCE1. 3' TAC ATC CGC TTA CGT CTG ATC GCT 5'2. 3' TAC GCG CTT ACG TCT GAT CGC T 5'3. 3' TAC CGC TTA TTA TTA CGT GCT GCT ATC GCT 5'4. 3' TAC CGC TAA TTA TTA CGT GCT GCT ATC GCT 5'Amino acid of each mutated sequence _______________type of mutation of each mutated sequence _______________
- generated after a cDNA library is made unique sequences in the genome useful for mapping using sequence information all of the aboveA transposable element or sequence of DNA that can move within the genome Group of answer choices Transposon Okazaki fragments Reverse transcriptase PrimerWhat role does reverse transcription play in chromosomal maintenance? Give typing answer with explanation and conclusion
