Q: Why must the gene be inserted into a vector for it to be cloned?
A: Vectors are carriers of target DNA which are readily used in recombinant DNA technology. The most…
Q: Why is this technique used?
A: All cells must synthesize some proteins for their cellular function. The instruction for protein…
Q: Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.
A: PCR is a method widely used to rapidly make millions to billions of copies of a specific SNA sample.…
Q: Why isn’t cDNA synthetic
A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…
Q: Difference between red-labelled and green-labelled cDNA preparations.
A: Difference between red-labelled and green-labelled cDNA preparations.
Q: five applications of CRISPR/Cas system in diagnosis and therapy with examples.
A: CRISPER Stands for clustered regularly interspaced short palindromic repeats, it is a Genome editing…
Q: e CRISPR associated protein tinal
A: C) CRISPR is a tool of genome editing by using the endonuclease cas9, when the gene is cut by genome…
Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…
A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…
Q: What color colonies will cells that contain a recombinant plasmid form?
A: Recombinant plasmids are the vectors that carry target DNA or gene sequence to the host by the help…
Q: RNA polymerase synthesizes the growing RNA transcript in the 5′-->3′ direction. True False.
A: Transcription is the process of forming an RNA copy of a gene sequence. This copy, called a…
Q: AKS 5c1: The process represented in the model involves the creation of a molecule that is…
A: Transcription is a process that helps convert the information in the DNA strand into RNA in the…
Q: ATCGTCA AGGCCTA ATCTCAA AGGCCT A Original Strand Mutant Strand Types of Mutation Explain/Why
A: Mutation:- Any alteration in the sequence of DNA that results in altered function or non-functional…
Q: Circle the correct word or phrase in each bracketed region to complete a correct statement.…
A: CRISPR gene editing CRISPR is Clustered Regularly Interspaced Short Palindromic Repeat. It is a…
Q: 30) In the CRISPR system, the targeted DNA sequence is
A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…
Q: True or False: When transcribing the missense strand the direction of growth is towards the…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: could you write about 4-5 sentences explaining what CRISPR is
A: Humans started manipulating genome initially by controlling breeding and through selection of…
Q: Create a simple outline (yes, you can use bullets and outlines!) starting from plasmid DNA with your…
A: Bacterial transformation is a key step in molecular cloning, the goal of which is to produce…
Q: Identical twin brothers begin life with identical genomes andepigenomes. How will this circumstance…
A: Identical twins share same genome and epigenome as they are born from same zygote, or it can be said…
Q: G-C rich DNA and A-T rich DNA. Which is more prone to errors
A: AT-rich DNA is mostly with condensed chromatin, however GC-rich sequence is located in the dispersed…
Q: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA CGG GAC CGG TGG GCC CAC TGA CAC mRNA…
A: In molecular biology, genetic code defines the conversion of DNA into m RNA and m RNA into its amino…
Q: how PEV is used to identify heterochromatin components
A: Heterochromatin is a type of chromatin. Chromatin is a structure of DNA wrapped around histone…
Q: Describe the main technique for amplifying a segment of DNA (like the one you suspect is involved in…
A: Polymerase chain reaction is a method used to make several copies of a specific target DNA.
Q: overlapping one another and amplifying themselves. Where do you expect to see bands of Primer dimer…
A: Primer dimers are commonly caused due to contamination of our DNA sample and can be observed as a…
Q: Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how…
A: Recombinant bacteria or genetically modified bacteria are produced when a gene of interest is…
Q: The lagging strand is replicated with stretches of Okazaki fragments and its synthesis is considered…
A: Okazaki fragments are short sequences of DNA nucleotides that are synthesized and later linked…
Q: Northern blots are used to ________. map genomes detect gene expression isolate DNA
A:
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: A set of nucleotides in an original DNA strand reads: TAC GCG AAT Transcribe this short DNA…
A: Gene is the sequence of nucleotides in a DNA. It encodes a protein.
Q: Select all true statements regarding CRISPR: A. CRISPR stands for Clustered regularly interspaced…
A: Genome editing refers to a set of techniques that enable scientists to alter an organism's DNA.…
Q: how can you explain Genetic Modification (CRISPR Cas-9 ) to someone who doesn't know anything about…
A: CRISPR was originally used to knock out target genes in varied cell varieties and organisms, however…
Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: gene definition
A: Allele are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: Transformation and sequence validation of the clones
A: DNA cloning is a technique of molecular biology. It is used to generate identical copies of a piece…
Q: What effect does the transposon have on the function of gene X in this figure?
A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…
Q: The blotting technique used toidentify the isolated protein is ________A. Northern blottingB.…
A: Proteins are the type of macromolecules that are synthesized in the cytoplasm during the process of…
Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…
A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…
Q: Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR…
A: The gene therapy or gene editing is an asset for humans, as many of the gene-related disorders can…
Q: Non-conventional genetic engineering transformation method for transfer of wheat lysine genes in to…
A: Introduction :- Genetic engineering is the process of modification of an organism's phenotype by…
Q: This quarter in lab, you have studied two different technologies that allow genome of a cell:…
A: Scientists have established several methods to edit the genome of a cell. These methods help to make…
Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…
A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…
Q: Pros and Cons of CRISPR-CAS9 please explain it in a simple language
A: Answer
Q: gun sequencing ncing every gene is mapped then
A: Shotgun sequencing is a method used for DNA sequencing. It is carried out by breaking the DNA…
Q: Briefly explain the significance of telomerase in normal cells versus tumors and cancer cells
A: In promulgating progenitor cells deduced from labile normal stem cells as well as in embryonic stem…
Q: Align your two superimposed fragments and look for a repeat
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Name and describe two important functions of eukaryotic DNA that do not code for protein.
A: 1. DNA ebilibity to code molecules like ribozymes (RNA which has ebility to catalyze biometabolic…
Q: The nucleosome assembly factor exclusively functions in DNA-dependent nucleosome assembly and binds…
A: Eukaryotic chromatin assembly factor 1 ( CAF -1) forms a protein complex that mediates the assembly…
Q: hat changes to the CRISPR system are done inorder to use it to methylate the chromatin
A: The prokaryotes such as bacteria and archaea contain the adaptive system called CRISPR/Cas system.…
Q: When the genetic materials are improperly replicated and error cannot be corrected the cell proceeds…
A: Cell cycle is the process by which a cell grows and divides to produce daughter cells. It can be…
Q: Cas9 is a protein that cuts nucleic acids a delivery vector a small DNA binding…
A: Introduction CRISPR/Cas9 is a technology for modifying DNA in a genome, an organism's whole set of…
somatic cells and CRISPR Cas9
Step by step
Solved in 2 steps
- What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicinganswer all subpart to upvote because vert short question otherwise dislike Viruses that infect bacteria (bacteriophage) sometimes encode a lysozyme gene in their genome. The gene gets inserted into the bacterial genome and gets expressed in the same way that bacterial genes get expressed. A) What location in the bacterial cell would the gene get transcribed into mRNA? (1 sentence max) B) What protein complex would perform the transcription to produce the mRNA? (1 sentence max) C) Where in the bacterial cell would the gene get translated? (1 sentence max) D) What protein complex would perform the translation to produce the protein? (1 sentence max)3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
- UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'
