Why do you increase the pH to denature the plasmid and chromosomal DNA during alkaline lysis rather than using high temperatures, which would also denature DNA?

1. Name all the proteins that are in the DNA replication fork in E. Coli, and describe the functions of these proteins. Explain how two DNA strands are replicated at the same time by one replication fork.

explain F' plasmid transfer diagramatically

2. Replicate this strand of DNA:GCA TAG CAA TGC

1

1.In a cell culture you are tracking cell division and DNA replication. You start with 100 cells, and let the cells divide two rounds with fluorescent nucleotides present in the media, instead of normal nucleotides. This allows for the visualization of the DNA under a fluorescence microscope. After two rounds of division, you remove the fluorescent nucleotides, and let the cells divide one more round.  How many NON-fluorescently labeled cells do you expect to find? Select one: a.800 b.100 c.400 d.0 e.200   2.  Which of the following are protein - RNA complexes? a.Polymerase b.Ribosome c.aminoacyl trna synthetase d.Spliceosome

04.PMA Which nitrogenous base correctly pairs with adenine on the DNA strand during replication? uracil thymine O guanine O cytosine

Plasmid alone should be ....... after adding the enzyme dna ligase.   become circular  single stranded    degraded   remain linear

1. It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand:GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT