Which type of motifs/folds are found in the protein shown below O Colled-coil O EF Hand O Horseshoe O Rossmann O Jelly roll O Greek key O Alpha/beta barrel O Beta barrel O Beta sandwich OZinc finger

A polypeptide is digested with trypsin, and the resulting segments are sequenced:             Val-Gly             Ala-Ala-Gly-Leu-Trp-Arg             Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation:             Ala-Ala-Gly-Leu-Trp             Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr             Ala-Ala-Asp-Glu-Lys-Val-Gly             What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).

Changing one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missense

Draw beta sheet with backbone hydrogen bonds, is this structure on the interior or exterior of the protein and why?   Region 1: -Ser-Thr-Glu-His- Region 2: -Asp-Tyr-Lys-Asn

Name the protein structural element shown in yellow in the figure: B-barrel reverse turn disordered region a-helix parallel ß sheet

Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop

Which of the following polypeptides would be most likely to form an a helix? Explain your answer. Cys-Arg-Ala-Gly-Asn-Arg-Lys-Glu-Thr-Tyr-Ile-Val-LeuSer-Glu-Asp-Asn-Phe-Gly-Ala-Pro-Lys-Ser-Ile-Leu-TrpGln-Lys-Ala-Ser-Val-Glu-Met-Ala-Val-Arg-Asn-Ser-Gly   β sheets are less likely to form than a helices during the earliest stages of protein folding. Explainwhy this is the case. (hint: think about the hydrogen bonding requirements)

Which amino acid sequence will form part of which protein structure, and why?   Sequence 1: Ser-Phe-Gln-Val-Lys-Leu-His-Tyr-Asp-Val   Sequence 2: Glu-Tyr-Leu-Asn-Phe-Ala-Gln-Val-Leu-Arg    __Amphipathic beta strand  __ Amphipathic alpha helix

Second letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letter

Draw the peptide formed between asparagine and histidine. H,N- -CH-C-OH H,N-CH-ċ-OH ČH2 ČH, N° NH2 -NH +