Which of the following statements are TRUE? I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand. II. The DNA strand that is used to make a complementary daughter strand is called the parental strand. III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′- triphosphate. IV. The incoming nucleotide always

Which of the following statements are TRUE? I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand. II. The DNA strand that is used to make a complementary daughter strand is called the parental strand. III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′- triphosphate. IV. The incoming nucleotide always

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section14.3: Dna Replication

Problem 1SB: What is the importance of complementary base pairing to DNA replication?

See similar textbooks

Similar questions

Why is DNA replication called semiconservative?
Which of the following statements are TRUE?I. DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.III. The precursor of each new nucleotide in the DNA strand is a deoxynucleoside 3′-triphosphate.IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide
Which of the following statements about RNA is/are incorrect? I. RNA strand synthesis does not occur during replication. II. All RNA strands produced during transcription are translated into proteins. III. RNA strands are composed of 10 nucleotide bases per turn. IV. RNA strands can pair with a DNA strand. V. RNA may be synthesized in the 5'-3' orientation and vice-versa (3'-5') depending on the orientation of the template DNA strand O I, II, and IV O I, II, III, IV, and V O II, IV and V O II, IV and V OI, II, III and V O Il and III
Below is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?
Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)
The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.
Which of the following statements about the processes of the central dogma is/are incorrect? I. Replication occurs only once during the life cycle of a cell. II. The entire sequence of a DNA molecule carries instructions for the synthesis of proteins and nucleic acids. III. The products of transcription all eventually undergo translation. IV. Transcription and replication both involve the use of RNA molecules. V. The translation of the genetic code is directly based on the sequence of the template DNA strand. O , I, and V O II, II, and V O l and IV O II, II, and IV O Only l is incorrect
The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.
Draw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’
(a) Eukaryotic DNA replication is more complex than prokaryotic replication. Give one reason why this should be so. (b) Why might eukaryotic cells need more kinds of DNA polymerases than bacteria?
Illustrate some steps involved in DNA replication :Suppose the following base sequence was found in a segment of one strand of a DNA molecule: 3’ A-A-T-A-C-C-T-C-C-T-A-A-C-T 5’ What would be the bases in the complementary strand? Label the 3’ and the 5’ ends. Illustrate the DNA molecule below. Label the 3’ and the 5’ ends of both strands. Separate the above DNA molecule up to the seventh base. Add one primer for the leading strand complementary to the first base Adenine of the template strand. Add one primer for the lagging strand complementary to the seventh base Adenine of the template strand. Illustrate the DNA molecule. Label the 3’ and 5’ ends. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate the resulting DNA molecule. Label the 3’ and the 5’ ends of the template strands and the complementary strands. Elongate the new strands up the seventh base by adding DNA bases complementary to the template strand. Illustrate…
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…