Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Which of the following statements are TRUE?
I.DNA replication is a semiconservative process wherein the two resulting double helices consist of one new strand and one parental strand.
II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.
III. The precursor of each newnucleotide in the DNA strand is a deoxynucleoside 3′-
triphosphate.
IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide
I.
II. The DNA strand that is used to make a complementary daughter strand is called the parental strand.
III. The precursor of each new
triphosphate.
IV. The incoming nucleotide always attaches to 5′-phosphate of the previously added nucleotide
a. I only
b. II only
c. I and IV
d. III and IV
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strandarrow_forwardThe region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’arrow_forwardDuring replication of a DNA molecule, the daughter strands are not produced in exactly the same manner. One strand, the leading strand, is made continuously toward the replication fork, while the lagging strand is made in fragments in the opposite direction. This difference in synthesis of the two strands is the result of which of the following? O a. DNA polymerase is not efficient enough to make two "good" strands of DNA O b. The two template strands are antiparallel, and DNA polymerase can only synthesize DNA in the 5' to 3' direction O c. The lagging strand is the result of DNA breaks caused by exposure to UV light Od. The cell does not contain enough nucleotides to make two complete strands Oe. Both B&Darrow_forward
- DNA has unique properties that allow it to accurately retain genetic information, even after multiple rounds of replication. One aspect of DNA that allows it to accurately store genetic information is the base pairing from Chargaff's first rule of the four nucleotide bases. If the A content of a DNA molecule is 18%, what are the percentages of the remaining bases? T = G = C = % % %arrow_forwardA space probe returns from Mars where it has collected a new microorganism. It has double- stranded DNA as its genetic material, and your studies show that it uses a semiconservative replication process. Your studies also show that DNA synthesis is continuous on both the leading and on the lagging strand. What do you conclude about the microorganism?arrow_forwardThe final steps of DNA synthesis involve the removal and replacement of primers with DNA, and the formation of the final phosphodiester bonds of the backbone which join all the fragments into one unbroken strand of DNA. True or false?arrow_forward
- 45. The double helix structure of deoxyribonucleic acid (DNA) is shown above. When DNA replicates, the two strands must "unzip." Which statement describes the energy requirements and forces involved? (A) Energy must be added to break the covalent bonds. (B) Energy must be added to break the hydrogen bonds. (C) Energy is released when the covalent bonds break. (D) Energy is released when the hydrogen bonds break.arrow_forwardIn NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication?arrow_forwardDNA replication involves a series of steps, including initiation, making primers, extension, and connecting DNA fragments. The cell uses different enzymes in a particular order to accomplish these steps. Which of the following represents the correct general order of enzyme use? A. DNA polymerases, helicase, primase, ligase B. Helicase, ligase, primase, DNA polymerases C. Helicase, primase, DNA polymerases, ligase D. Primase, helicase, DNA polymerases, ligasearrow_forward
- DNA replication is semi-conservative, this statement means that Question 6 options: a) the new DNA molecules that are made are not identical to the original DNA molecule. b) the new DNA molecules that are made are only partially DNA since RNA primers are included. c) the new DNA molecules that are made are composed of one strand of the old DNA molecule and one strand of new DNA. d) of the two new DNA molecules made, one is entirely new DNA and one is entirely old new. e) the new DNA molecules that are made have a mixture of old and new DNA in each strand of the DNA duplex, randomly interspersed.arrow_forwardSemiconservative replication of DNA means that: a. both daughter duplexes will be entirely new and the parental duplex will be degraded b. each daughter duplex will have one of the original parental strands and one new strand c. each strand of the daughter duplexes will have parts of the parental strand and parts of the new strand d. one daughter duplex will be entirely new and the other will have both original parental strandsarrow_forwardDNA replication is vital for successful cell division. Explain the process of DNA replication. Make sure to use the following terms: helicase, S-phase, DNA polymerase and DNA ligase, template, free nucleotides. Use the diagram if it helps you illustrate your points.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education