Which of the following is the densest TAG? Otrimyristin triolein O tristearin Otripaltristearin mitin

Q: Which of the following is true regarding aceto-orcein staining? The active dyes in this strain are…

A: Option (d) is incorrect. As because the main aim of acetic orcein stain is to study the different…

Q: expanded structure of the D-tagatose Fischer projection of D-tagatose Haworth projection of…

A: The objective of the question is to understand the different structural representations of…

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: The amount of light entering the eye is determined by the size of the: O The pupil O The lens O The…

A: Pupil present in the center of iris .The amount of light entering the eye control by the size of…

Q: Cons of CRISPR

A: The cons or disadvantages of CRISPR  are as follows:

Q: draw the teeth smear with methylene blue on positive simple staining in 1000x objective

A: The teeth smear can be obtained to detect the presence of microbes present in the oral cavity and…

Q: Which of the following is luminous? ⦁    Star ⦁    Bird ⦁    Cup ⦁    Bat ⦁    Stapler

A: Our solar system consists of several planets revolving around Sun. When we look above in the sky we…

Q: A B C D E F G Use the following tree to answer the question below. Which of the following trees, if…

A: A phylogenetic tree is defined as a branching diagram or tree that depicts the relationships that…

Q: Why is it necessary to prepare both NSS and Iodine Smears?

A: Stool smear:   A stool test is a type of medical diagnostic procedure that includes gathering and…

Q: can you specify what are they positive for? like   Positive for Xanthoproteic test  (letters)**…

A: Phenols are compounds that have one or more hydroxyl groups attached to a benzene ring.…

Q: Transillumination is used clinically for the detection of:

A: Transillumination is an examination that is done with the help of a strong light shining on a…

Q: The sliding clamp proteins are also known as PCNA.   true or false?

A: Replication of DNA is a biological process that happens in living organisms and it is important for…

Q: Dye name Lane/well number ... Distance traveled ... To which pole (+/-) ... ... 1 BB-Bromophenol…

A: In biology, dye is a chemical colouring material, consisting of chromophore and auxochrome groups…

Q: e 0---H-N CH2 N-H---N d 0--H-N CH, N-H---N N-H---0 CH2 j N-H---O CH2 N---H-N }. CH, N-H-0 N---H-N…

A: --->This is the DNA sequence and it is made of A POLYMER of NUCLEOTIDES. A nucleotide consists of…

Q: A M N D K H

A: A - eft lobe B - Right lobe C - Caudate lobe D - Quadrate lobe E - Falciform ligament F - Round…

Q: Know about the different staining techniques (simple, direct, negative, and differential), what is…

A: Staining techniques can provide valuable information about the morphology, structure, and…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: What are the principle and basic concepts of DIFFERENTIAL staining?

A: The simple dye is used in the technique of simple staining to highlight only the specific structures…

Q: Identify the structure indicated by the Yellow arrow.

A: The human body is a well built machine in which all the organs coordinate together to make it work.…

Q: How long does it take fir alcohol to completely denature the albumin proteins

A: Proteins are required for all living things to function properly. they're massive compounds composed…

Q: Acid-Fast stain M. Smegmatis -morphology shape -Arrangement -Acid-fast or non-acid-fast

A: Introduction :- Mycobacterium smegmatis is a rod-shaped bacterium that is commonly used as a model…

Q: Has 53' DNA polymerase activity [Choose] [Choose ] RNA polymerase DNA polymerase I Coats…

A: Replication is the first and most important stage in the central dogma of the cell machinery. In…

Q: Below is a picture of DNA fingerprints of eight members of thể Khlght family. Individuals 4, 6, and…

A: DNA fingerprinting is a laboratory technique used to establish a link between biological evidence…

Q: Write the name of disease occur due to Nonhomologous End Joining Repair.

A: When their is defective  Function of DNA  break repair , then it is known as DNA repair defect which…

Q: What are the principle and basic concepts of NEGATIVE staining?

A: Introduction Staining is a technique for enhancing contrast in material, usually on a microscopic…

Q: Describe the term SDS-PAGE.

A: Charged particles migrate during electrophoresis under the influence of an electric current. For…

Q: Please answer fast  What chemical is the mordant in the Gram staining procedure. Explain how it…

A: Given: Gram staining procedure was given by Hans Christian gram in 1884.It is a technique that…

Q: During streaking plate, why is it necessary to flame the loop in between 1st and 2nd streaks?

A: Introduction: The word "streak" is defined as "a long, thin line."In a petri dish, a sample is…

Q: Å Q/ Why don't we fixation to simple negative staining?

A: It is method followed to help view a specimen under the microscope to study its morphological…

Q: The scale bar in panels (a) and (d) in this image is 50 um (micrometeraj. Question: Which of the…

A: Microscope   A device use to visualise non visible extremely small microorganisms.

Q: Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable…

A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…

Q: 6) Label highlighted (purple) structures

A: Nervous system is a part of body system that helps with control, coordination and transmission of…

Q: What staining is used for this microspecimen? a. Methilen blu b. Toluidin blu c. Eosinophilin d.…

A: Microspecimen staining is a scientific method for coloring microscopic samples of tissue or cells.…

Q: List three coating techniques used to make sol-gel coatings, and briefly describe each technique.

A: Sol-gel  Is a method of creating solid materials from tiny molecules.  The process involves the…

Q: Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.

A: Gel electrophoresis technique of separation of molecules on the basis of their size and charged…

Q: Describe the basic differences between CPT and HCPCS Level II codes. Explain the purpose of the…

A: Both CPT and HCPCS Level II codes are utilized in the healthcare sector to define medical…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: ge 8000 00 000 8 bo ర o

A: Blood contains a cellular portion known as formed elements and a fluid portion known as plasma. The…

Q: Which of the following explains why SV40, HPV, and Adenovirus have such long replication cycles as…

A: This question concerns the replication cycle of infections, particularly DNA infections such as…

Q: Modify methionine to show its zwitterion form.

A: Here an amino acid "Methionine" is given which has following structure:-

Q: why does cheese smell

A: Cheese is a dairy product that is formed by the coagulation of casein(milk protein). It is usually…

Q: Why is nigrosin-water- bacteria puddle need to be mixed in a Simple/Negative staining

A: Staining is a technique used in slide preparation to color the specimen. With light microscopy,…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: Is K2EDTA same as Spray-coated K2EDTA?

A: K2EDTA stands for dipotassium ethylenediaminetetraacetic acid and is a strong anticoagulant used…

Q: What are the principle and basic concepts of Simple staining

A: The simple staining doesn't give a lot of data about the cell separated from the bacteria'…