Which of the following is NOT a type of cell? A. ribosome B. haemocytoblast C. neutrophil D. phagocyte

Q: QUESTION 22 Which of these statements is false? O Physical activity increases the risk of adverse…

A: One of the reasons for the rapid rise in obesity in adults and children is the inexpensive…

Q: Press the hotspot that indicates a human activity that adds carbon dioxide to the atmosphere. CARBON…

A: Human activity that results in carbon dioxide emission is :-

Q: Recognizing Macromolecules in Food

A: Macromolecules are very large molecules created by the polymerization of small units called…

Q: 1) Describe the growth morphology obtained from both Bacterial Growth Count (TSA) plates and Fungal…

A: Introduction :- The number of actively growing/dividing cells in a sample can be determined using a…

Q: Order the following structures of the kidney in the sequence in which fluid passes through them on…

A: The kidneys are two reddish bean-shaped organs on either side of the spine, lying below the rib…

Q: extinction

A:

Q: Which antibiotic is part of our innate immune system? Group of answer choices trimethoprim…

A: Lysozyme are the Type of enzymes which are found in tears, milk and saliva. These lysozyme kill…

Q: 10. Sperm cells are produced by the A. seminal vesicles B. prostate gland C. epididymis D.…

A: The human sperm was first seen by Antony Van Leeuwenhoek in the year 1677. A mature sperm cell is a…

Q: Based on figure 17, to whom are archaeans more closely related: bacteria or eukaryotes?

A: Scientifically all life is divided into three forms  ; archae , Bacteria and eukarya .  All of them…

Q: After intense excerise, an athelte needs to have a high-carbohyrdrates meal within 24 hours? A.…

A: The daily diet and nutrition of an athelete is different as they workout more than normal person.

Q: Name the three divisions (parts of the ear).

A: We will answer the first question as exact one question is not specified. Please send back the…

Q: Turpentine oil is obtained from- (A) Coal (B) Petroleum (C) Cedarwood (D) Pinus

A: Introduction - Turpentine is a liquid produced by distilling resin from living trees, primarily…

Q: What are the 6 characteristics of inflammation? Which of these 6 characteristics are signs and which…

A: Introduction:- Inflammation is a reaction to harm to living tissues. The inflammatory response is a…

Q: Increased neutrophil cell counts

A: Neutrophils: Neutrophils are the most abundant type of granulocytes and white blood cells in most…

Q: why do some rats succesfully learn the moris water maze and some dont. These rats over a large…

A: Morris water maze test is a test commonly used test to study spatial learning and memory in animals,…

Q: Incorrect Question 6 Which conditions would NOT lead to good preservation of a dead hominin…

A: Ans is-- Dying in an open grassland that is seasonally dry or wet.

Q: Fats are the primary fuel source utilized in both anaerobic and aerboic exercise? A. True B. False

A: Fats: Fat is a term used in nutrition, biology, and chemistry to describe any ester of fatty acids,…

Q: Name of organisı Features used to ID: d.

A: The given diagram shown is the diagram of the filamentous green algae that lives in the fresh water…

Q: uestion 6 hich conditions would NOT lead to good preservation of a dead hominin skeleton? Dying in a…

A: Erect posture, bipedal mobility, larger brains, and behavioural features like as specialised…

Q: How is cystic fibrosis inherited

A: Cystic fibrosis is a disease that affects the lungs and organs of the digestive tract due to…

Q: What are the complections Of tooth extraction?

A: Introduction The removal of a tooth is known as tooth extraction. "An ideal tooth extraction is…

Q: If one child had the STR alleles 7 and 10 (7/10) and their sister had the 8/10 then their parents…

A: ANSWER;- either 7/10 and 8/10 or 7/8 or 10/10

Q: indicators, key used for/ determines reagents, or key positive result ingredients |1. crystal violet…

A: Different types of culture media are used to support microbial growth and various test performed to…

Q: Discuss ideas about race with regards to athletics, IQ, and medicine. Why are outdated ideas about…

A: As anthropologist Janet Shim points out, race has become so ingrained in medical practice that it…

Q: There are currently no federal guidelines or practices to ensure the purity, quality, safety, and…

A: FDA (Food & Drug Administration)is an agency of the department of health and human services,…

Q: 9. Which of the following statements about meiosis is correct? A. Gametes are haploid cells…

A: Meiosis is a type of cell division in which the parent cell is divided into four daughter cells such…

Q: What is NADP and NADPH?

A: Introduction - Plants can create ATP through a similar process during the light reactions of…

Q: In sulfur photosynthetic bacteria what is the molecule that donates hydrogen for photosynthesis?

A: Introduction - Sulfur-oxidizing bacteria are prevalent. Thiobacillus thiooxidans is a…

Q: Name three characteristics that set vertebrates apart from other animals

A: The phylum of vertebrates, which includes Aves, reptiles, amphibians, and mammals, is defined by the…

Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…

A: Introduction :- Fatty acids and lipids are other terms for fats. Three molecules are linked together…

Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides

A: Introduction - A gene is a basic unit of heredity in biology, as well as a sequence of nucleotides…

Q: A mutation in the spike protein of the SARS-CoV-2 virus has been detected in a strain that is…

A: The spike protein is made of a chain of amino acids that are folded into the 3D structure. Spike…

Q: What would be the consequences to the outcome of meiosis if SPO11 is absent? Explain your reason.

A: Meiosis is a type of cell division that produces four gamete cells by halving the number of…

Q: of В C

A:

Q: What is Reproductive (Male/Female) body system? What are the functions and major organs ? Describe 2…

A: The male reproductive system is responsible for producing and depositing sperm, whereas the female…

Q: Cofactor/domain that moves between active sites in the PDH complex. O TPP O FAD O biotin O lipoamide…

A: The pyruvate dehydrogenase complex connects carbohydrates to the tricarboxylic acid cycle. Pyruvate…

Q: Describe each way viruses may be classified. And Define each of the following parts of a virus,…

A: Capsid - A capsid is a virus's protein coating that encases its genetic material. It is built up of…

Q: What is phylogeny and morphology, and what are some of the pathogenic traits and animals that they…

A: Please follow step 2 for detailed explanation.

Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…

A: Pollution: Pollution is referred as undesirable change in the biological characteristics of water,…

Q: Define the following terms as they apply to Microbial Ecology: a. Fixation b. Production

A: A. Microbial fixation means to transform the complex chemicals to simple absorbable form so that…

Q: Under which of the following conditions wpuld sexual reproduction advantageous? A. In changing…

A: Sexual reproduction is the type of reproduction that involves the union of two gametes, i.e., the…

Q: China's total annual coal consumption is less than the United States' consumption True False

A: The answer is False.China's total annual coal consumption is more than the United States'…

Q: True or False: The management of septic shock is simple and straightforward. True

A: Poor tissue perfusion combined with compromised cellular metabolism results in significant…

Q: Based on his phenotype muggle, with the information provided, can we tell what Dudleys second allele…

A: Inheritance or heredity is passing-on one trait from the parents to the progeny by either asexual or…

Q: If the food is contaminated by bacteria, as long as fully boiled for over 10 minutes, it is still…

A: Introduction Bacteria are single-celled organisms that are tiny. Bacteria can be found practically…

Q: Why do cells need to be kept in the freezing devices first then transferred to liquid nitrogen…

A: Rapid freezing of cells can cause ice crystals large crystals can be formed in which cells are…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Bacteria use the following mechanism(s) to resist antibiotics:

A: Antibiotic resistance Antibiotic are the class of compounds that inhibits the growth of bacteria or…

Q: Analyze the graphs below. Which growth model (exponential or logis- tic) would apply to a population…

A: Population growth  Population growth can be defined as the increase in the number of organisms in a…

Q: When at rest, our muslces only use a small amount of fat to provide energy, no use of glucose at…

A: Glucose  It is a six carbon compound use by most of the living organism as fuel.

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.