Which of the following best describes the process of DNA replication? (type 1, 2 or 3 in the blank) 1. conservative model 2. semi-conservative model 3. dispersive model The model that best describes DNA replication essentially means 1. the DNA is kept intact and a copy is made by enzymes 2. the DNA is separated and a new daughter copy is paired to each parental strand 3. the DNA is dispersed into small nucleotide segments and copied pieces are inserted into the gaps

Which of the following best describes the process of DNA replication? (type 1, 2 or 3 in the blank) 1. conservative model 2. semi-conservative model 3. dispersive model The model that best describes DNA replication essentially means 1. the DNA is kept intact and a copy is made by enzymes 2. the DNA is separated and a new daughter copy is paired to each parental strand 3. the DNA is dispersed into small nucleotide segments and copied pieces are inserted into the gaps

Name: Which of the following best describes the process of DNA replication?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following best describes the process of DNA replication? (type 1, 2 or 3 in the blank)conservative modelsemi-conservative modeldispersive modelThe model that best describes DNA replication essentially means the DNA is kept intact and a

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

(Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose one: GAUDIe copy of a DNA molecule. complementa DNA replication is known exact molecule has 1 original stChoose one: 1 new strand of DNA. This ensures the conservation of genetic information. because each new DNA (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that are genetically Choose one: This process is used to make Choose one: Match the following Mitosis stages to what happens Prophase Metaphase Anaphase Telophase a. sister chromatids pull apart to opposite ends of cell b. chromosomes line up at the equator of the cell c. Nuclear envelope reforms and chromosome loosen d. nuclear envelope disappears, chromosoměs a. condense During what phase does the cytoplasm divide? (Select one answer from dropdown menu:) Choose one: (Select one answer from each dropdown menu and fill in the blank:) In meiosis, the goal is to get cells that are genetically Choose…
Which of the following statements is NOT TRUE about genomic DNA replication? O A DNA replication begins at the origin of replication and proceeds bi-directionally O B. New nucleotides can be added by the DNA polymerase only to the 3 end of the growing strand O. Synthesis of new DNA is catalyzed by the enzymes called DNA polymerases OD. DNA replication is semi-conservative OE. DNA replication proceeds continuously on both parental DNA strands.
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
Which of the following statements about DNA replication is correct? Group of answer choices the leading strand is replicated continuously, while the lagging strand is replicated discontinuously on the leading strand, the new nucleotides are added only to the 5' end of the nucleotide chain on the lagging strand, the new nucleotides are added only to the 5' end of the nucleotide chain DNA polymerase works from 3'--> 5' only
During replication of a DNA molecule, the daughter strands are not produced in exactly the same manner. One strand, the leading strand, is made continuously toward the replication fork, while the lagging strand is made in fragments in the opposite direction. This difference in synthesis of the two strands is the result of which of the following? O a. DNA polymerase is not efficient enough to make two "good" strands of DNA O b. The two template strands are antiparallel, and DNA polymerase can only synthesize DNA in the 5' to 3' direction O c. The lagging strand is the result of DNA breaks caused by exposure to UV light Od. The cell does not contain enough nucleotides to make two complete strands Oe. Both B&D
Which of the following things must happen first if DNA is going to be replicated * DNA gets broken into smaller pieces to make the process more manageable DNA gets unzipped, so the two complimentary strands are separated DNA Polymerase adds on bases that match with the original strand DNA gets wound back into chromosomes so it's ready for mitosis Lenovo esc -> 女 # 2$ 2 3 5 6 7 8 9. tab e r t y a f k ift V alt ctri
Which of the following is correct about the function of DNA Ligase? DNA ligase is used on the leading strand and it joins any disconnected strand together O DNA ligase is used on the lagging strand which helps in joining fragments of the strand together O DNA ligase is used on the lagging strand and it aids in correcting mistakes on this specific strand O DNA ligase is used to maintain the replication fork structure
1. The diagram below depicts a DNA replication fork in a biological cell. The primer is shown by an arrow 5'-3'. A ATTATGTCTGGCCTTGAGTAAGGCTAATCACAT GCGTA GCAT Primer BTAATA TCATTC CGATT From the DNA diagram above, which ends (indicated as A, B, C & D) of the DNA template strand are the 5' and a. which are 3' ends? b. Which way is the direction of movement of the replication fork? Right or left of the figure. Which of the parental strands are the templates for leading (continuous) and lagging (discontinuous) strand synthesis?. Top or bottom strand. С. I d. Give the sequence of the five base long primer that is shown as an arrow in the diagram above 5' 3' Give the sequence of the next four bases that would be added to the growing end of the primer e. 5' 3'
Choose all of the true statements about DNA replication in cells. Hint: 2 statements are true. O Prokaryotic chromosomes contain hundreds of origins of replication. Primers are composed of RNA nucleotides that are complementary to the DNA template strand. DNA polymerase proofreads and replaces ALL errors during DNA copying Primers are short DNA sequences which DNA polymerase can bind to. O Eukaryotic chromosomes contain many origins of replication.
Below is a picture of a single origin of replication in a eukaryotic cell. 5' 3' 5' 1. On the figure above, Draw out where the following molecules will be located: Helicase; Sliding Clamp, Single Strand Binding Protein. 2. On the right hand side of the dotted line, the replication of which template strand (top or bottom) will be continuous by DNA polymerase? 3. On the left hand side of the dotted line, the complete replication of which template strand (top or bottom) will be more affected by a mutation that causes DNA ligase to be partially functional?
Below is a study of a colony of cells, determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. - What will the effect of the mutation in DNA polymerase I be on DNA replication? Include leading and lagging strand - Will this mutation in DNA polymerase I have an impact on another step in DNA replication? Will DNA be replicatation be impacted? Are any enzymes involved?
Which of the following statements is/are TRUE for DNA Replication? Two daughter DNAs are formed, each one contains an old and new strands. When the (parent) DNA strands unwind, the 3'→ 5' strand is the leading strand while the 5'→3' strand is the lagging strand. Requires dATP, dTTP, dGTP, dCTP and Mg2+ The replisome is the biological machine responsible in replicating DNA.