Which areas of the body are the most sensitive to touch? Least? Relate the size of the two-point threshold on different areas of the body to touch receptor density and receptive field size.
Q: About _____% of the variance between physical activity levels in humans is due to genetic variation.…
A: Taking care of fitness immediately allows us to be productive and provides us stamina and…
Q: Construct a cladogram from the data below. Four Limbs X X Animals Frog Rodent Lizard Gorilla Fish…
A: Cladograms are branching structures that resemble trees and illustrate the shared links between two…
Q: CC DD and cc dd plants were crossed to each other, and the F1 offspring were backcrossed to the cc…
A: Given 997 Cc Dd, 999 cc dd, 1 Cc dd, and 3 cc Dd Total = 2000
Q: Aerobic Salmonella enterica and some of the Gram-negative rods E. coli, share some of the classic…
A: Microorganisms play a crucial role in our lives, assisting us in digestion, waste decomposition, and…
Q: Describe how a nuclear protein is made and transported to its final destination.
A: Proteins are 3-dimensional structures that are involved in various functions in our body. Proteins…
Q: to facilitate movement of ions and molecules across membranes. to move food, water, and wastes…
A: The cellular membrane is partially permeable and controls the movement of substances into and out of…
Q: What is the importance of the GUS gene? Why is using GUS with Arabidopsis thaliana important ?…
A: Explanation: Beta-glucuronidase is an enzyme that plays a role in the breakdown of plant cell…
Q: Amylose Amylopectin
A: Introduction The most prevalent carbohydrates in food are called polysaccharides, or…
Q: 1. A 2 kb fragment of DNA was cut by EcoRI and BamHI and then analyzed by gel electrophoresis. The…
A: The restriction endonucleus are specific enzymes that are responsible for cutting phosphoruster bond…
Q: In quantitative determination of protein using spectrophotometer how can I plot the absorbance vs…
A: UV- visible spectroscopy is an important tool to determine the protein concentration in the sample.
Q: How can lifestyle changes affect chronic diseases management? In what way does early diagnosis help…
A: The term lifestyle can be referred to as a specific way of living that is utilized by the human…
Q: Many obese patients are part of a family in which all, or the majority, of it's members are obese.…
A: Genes are information/ trait encoding units present in the genome or DNA of organisms. These genes…
Q: an excitatory synapse and inhibitory synapse generate postsynaptic potentials on the same neuron…
A: PSP defines the changes of electric potential in a neuron for a transient period of time. It happens…
Q: Discuss the steps you would proceed after selecting your E. coli strain from question 2.(a) up to…
A:
Q: Use this storyboard to write and illustrate the journey of an egg from ovulation to menstruation.…
A: The egg is formed in the ovary of a female. The eggs are present in the female since birth. Each…
Q: B-lymphocytes convert into plasma cells, before they produce antibodies. Which of the following…
A: phagocytes, a type of living cell, devour or engulf other cells or particles through a process known…
Q: Describe the ff types of microscope: A. Darkfield microscope B. Phase contrast microscope C.…
A: Microscope is an equipment that can help to observed very small object and cells.
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…
A:
Q: Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU(…
A: Introduction The genetic code is a set of instructions that enable live cells to produce proteins…
Q: When a population evolves to be better fitted to its environment, this is an example of , which is…
A: Natural selection is the variation in individual survival and procreation brought on by phenotypic…
Q: Illustrate how gene flow works and how it may inhibit evolution.
A: Gene migration is another name for gene flow. The movement of genetic material from one group to…
Q: Explain the the following cell theory: - all living organism are composed of one or more cell -…
A: Cell Theory: According to the CELL THEORY, or cell theory, all creatures are made up of comparable…
Q: Binding EGF to the EGF receptor causes phosphorylation of tyrosines on the cytoplasmic tail of the…
A: Tyrosine kinases are essential mediators of this sign transduction process, main to…
Q: What happens if plasma membrane fails to maintain optimal fluidity? • Describe structure/function of…
A: * plasma membrane is the envelope like structure that surrounds the cell and its organelles . *It is…
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A: Introduction Cell transports are the movement of a material through the cell membrane. The chemical…
Q: What is the main difference between allopatric and sympatric speciation?
A: Speciation is a process in which origin of new species takes place in a population depending on a…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: Introduction The term "membrane transport" refers to a group of systems that control the movement…
Q: Discuss at least three methods of DNA extraction and summarize each methods using a schematic…
A: DNA extraction is a technique to separate DNA from cell membranes, proteins, and other biological…
Q: If the two populations in question 2 are determined to still be the same species, did allopatric…
A: The mechanism through which populations develop into different species is known as speciation. In…
Q: Batch fermentation under the conditions described in part b) is carried out in a 100-liter Remember…
A: Penicillins are prescribed to cure diseases such as sore throats, meningitis, syphilis, and others.…
Q: Question 1 :Provide the anticodon sequence that would build this protein. Amino acid sequence: MET…
A: Note: Since you have posted multiple questions so we will be solving the first one for you. As per…
Q: Use this data, and sketch a graph by hand that would best fit the data. (think which type of graph…
A: Comb jelly fish Comb jellyfish is a marine invertebrate organisms belong to phylum ctenophora.
Q: What would be the effect on the following processes in a cancer cells treated with Drug X. Match the…
A: Cancer is defined as a condition of uncontrollable cell division resulting in the formation of cell…
Q: The _____________ plants died, partially decomposed, and became the fossil fuels? (choose all that…
A: Sphagnum Moss: There are over 380 recognised species of mosses in the genus Sphagnum, which is also…
Q: State 3 important results of meiosis.
A: Dividing phase of a cell cycle is the phase of actual division. ON the basis of cell type in which…
Q: Proteasome inhibition might lead to an immediate ________ Select one: a. increase in cysteines b.…
A: Proteasome works in conjunction with ubiquitin. Proteasomes are found in the cytosol, both free and…
Q: The fossil record shows that the first mammals evolved 220 million years ago. The supercontinent…
A: Fossils are the remains of ancient or former living organisms whose biological evidence suggests…
Q: What is the purpose of control tubes in an experiment? a. To use up more tubes and look more…
A: The unknown sample is tested and compared to positive and negative controls to determine the test…
Q: Nucleic acids have a definite polarity, or directionality. Stated another way, one end of the…
A: Explanation: Polarity, also known as directionality, is a property of nucleic acids that describes…
Q: A type of cell transport wherein large particles such as food and bacteria are engulfed through…
A: The term endocytosis was coined by Christian de Duve in the year 1963. Endocytosis is a process…
Q: Which of the following is true of mitchondria and plastid evolution in Eukaryotes Plastids evolved…
A: Mitochondria A organelle of eukaryotic cell that performs the function of respiration.
Q: Identify a false statement moist environment promotes bacteria colonization within our body O…
A: Bacteria Bacteria are classified under the kingdom Monera , they are prokaryotic cells. In bacteria,…
Q: What forces drive solutes from one side of the membrane to the other? • What solute properties…
A: Introduction: Because they control which chemicals can pass through and how much of each material…
Q: Compare and contrast convergent evolution and evolution by common descent, and give an example of…
A: Evolution is the process by which heritable traits change over time. There are two main types of…
Q: 1. Using the hereunder template, enumerate the different digestive enzymes: Enzyme Category Enzyme…
A: All the digestive enzymes are classified as hydrolases because they breakdown large and complex food…
Q: For some kinds of experiments, biologists use isolated cells grown in culture. Cells differ…
A: Doubling time is the time taken for cells to complete one cell division. It varies for each…
Q: Name the four compartments of the stomach of ruminant. Which two are located primarily on the left…
A: Ruminant animals, such as, cattle, goat, deer, horses, camels, possess a special type of stomach,…
Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.
A: According to their shared evolutionary parent, distinct species of animals with similar structure,…
Q: Which word best describes the image illustrated? P m tetrad staphylococcus Opalisades…
A: Bacteria They are prokaryotic unicellular organism which may be beneficial or harmful to human being…
Which areas of the body are the most sensitive to touch? Least? Relate the size of the two-point threshold on different areas of the body to touch receptor density and receptive field size.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given that receptive fields for touch do not exhibit uniform sensitivity across their whole extent, describe the two patterns of response sensitivity. And do these two types convey essentially the same or different information to the brain?Fill out the information indicated for tactile receptors in the table below: Name Structure Location Function. (encapsulated or unencapsulated?) Tactile disc Tactile corpuscle Free nerve endings End bulb Bulbous corpuscle Root hair plexus Lamellated corpuscleHow does the size of various parts of the primary somatosensory cortex relate to touch sensitivity and to receptive field size?
- Identify, in correct order, of sensation to perception, the major connections of the pathway underlying fine touch, and pressure. afferent axons decussate at medulla primary somatosensory cortex activated somatosensory humunculus according to where on body touch was felt free nerve endings depolarize dendrites of peripheral afferents axons in the medial lemniscus terminate in the ventral posterior nucleus of the thalamus axons of afferents enter into dorsal horn of spinal cord and ascend ipsilaterallyWhich receptors fire at the onset and the offset of stimulation? Select all that apply. Select one or more: Tendon organ Thermoreceptors Type II cutaneous mechanoreceptor (Ruffini corpuscle) Type 1 cutaneous mechanoreceptor (Merkel disc) Lamellated (Pacinian) corpuscle Hair root plexus Corpuscle of touch (Meissner corpuscle)Identify six types of tactile receptors found in the skin and their sensitivities.
- A more developed two-point tactile discrimination :-a- indicates a greater threshold distance for feeling of two points of touch applied simultaneously b- is seen in the proximal regions of the body compared with the distal regionsc- is inversely related to the size of the receptive fields of the stimulated sensory unitsd- depends upon the type of the involved touch receptorPrecise localization of a somatosensory stimulus is improved by: Increasing frequency coding Increasing population coding Decreasing receptive field size O Lateral inhibition Increasing receptive field sizeReceptor A has a circular receptive field on the skin with a diameter of 2.5 cm. Receptor B has a circular receptive field 7.0 cm in diameter. Which receptor provides more precise sensory information?
- Why can tactile stimulus be localized in parts of our body better than other parts?Describe each of the following types of receptors, indicating what sensation it detects and giving an example of where it can be found in the body: pain receptors (nociceptors), temperature receptors,mechanoreceptors (including proprioceptors and barorceptors/pressoreceptors), chemoreceptors, and photoreceptors.What is the phisiology of adaptation of touch and temperature receptors?