Q: Why are the similarities among organisms during early development evidence for evolution? Give an…
A: Evolution is the gradual change in the inherited traits of natural populations over many…
Q: Compare/contrast – passive diffusion vs. passive carrier-mediated transport – passive…
A: Transport The transport of molecules across the cell wall and cell membrane. It takes place by two…
Q: Is protein a tertiary structure?
A: Introduction: Protein is a crucial macronutrient found in all living things . In our muscles, bones,…
Q: Explain why there is no arrow that shows carbon atoms gojng from the soil to the tree based on the…
A: Carbon cycle is the movement of carbon atoms from atmosphere into organisms and plants and back to…
Q: Why does the population of S. aureus bacteria not pose a life-ordeath health threat outright?
A: The comprehensive research of microorganisms, whether they have one cell, many cells, or are…
Q: Cat DNA is much more similar to dog DNA than to tortoise DNA. Why? (a) Cats and dogs are both…
A: All living things have the same genetic material (DNA), comparable genetic codes, and the same…
Q: Which of the following helped to lay the groundwork for understanding the record of historical…
A: The Earth was created by deposition from the solar nebula approximately 4.54 billion years ago,…
Q: Parallel evolution, convergent evolution and character state reversals are all examples of Select…
A: Parallel evolution is the evolution of independent species, which share the same characteristics.…
Q: Organisms have the following genotypes. What types of gametes will these organisms produce, and in…
A: Introduction : All sexually reproducing organisms have sex cells called gametes. The gamete produced…
Q: One of your classmates performed a gram stain on Pseudomonas aeruginosa and found variable gram…
A: The "cell wall of Gram-positive" bacteria is mostly composed of peptidoglycan layers that form a…
Q: Sickle cell anemia is a human genetic disorder caused by an autosomal recessive allele. A couple…
A: Introduction One of the genetic diseases known as sickle cell disease is sickle cell anaemia. Red…
Q: (1) What is the major difference between the conventional PCR and real time PCR (qPCR) in terms of…
A: Question. What is the major difference between the conventional PCR and real time PCR (qPCR) in…
Q: Why do vestigial structures still exist if they are no longer useful?
A: Anatomical structures in an organism that are deemed to have lost most or all of their primary…
Q: Please answer fast which modern tecniques used in following countries for the production of…
A: Modern agricultural techniques are farming techniques that include a lot of labor, huge financial…
Q: In corn, pigmented aleurone (R) is dominant to colorless aleurone (r), and green plant color (G) is…
A: Given Green (G) is dominant over yellow (g) Pigment (R) is dominant colourless (r) Plant one…
Q: Which species is/are sympatric with Echinometra lucunter?
A: When two interrelated species or populations coexist in the same region and come into contact with…
Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…
A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…
Q: Monophyletic groups are desirable in classification as they Select one: a.reflect evolutionary…
A: Monophyletic group has all descendants taxons from a single common ancestor. Classification is…
Q: How many species are present at year 1000? Justify your answer (i.e., clearly explain your…
A: The term species can be defined as a group of individuals that are able to inbreed. Speciation is…
Q: The Size of Cells and Their Components: a. (a) If you were to magnify a cell 10,000 fold (typical of…
A: The microscope is the instrument used in biology laboratories to visualize microscopic particles or…
Q: Antibiotics are medicines that are used to fight bacterial infections. These medicines kill…
A: Antibiotic is a medicine that inhibits the growth of microorganisms or destroys it.
Q: Which of the following most likely has a sequence of hydrophobic amino acids that permits the…
A: Correct answer: (a) Translocator (TIM/TOM) The transport of proteins inside the mitochondrial…
Q: why is fluid mosaoc model called "fluid mosaic model" ?
A: Introduction :- Different facts on the composition of functional cell membranes are explained by the…
Q: 3. For every 3 turns of the Calvin Cycle, 1 molecule of G3P (Glyceraldehyde-3-Phosphate) is…
A: Calvin cycle is the light-independent process of photosynthesis that fixes carbon dioxide. It…
Q: Why do vancomycin-resistant bacteria have a higher frequency in the population after treatment with…
A: Vancomycin is a drug that is used to treat infections caused by bacteria. It works by killing the…
Q: What is the function of NEU?
A: Introduction HER2/neu is an oncogene whose protein product may function as a growth factor receptor.…
Q: 2. List the 4 biologically importance molecules (carbohydrates/lipids/proteins/nucleic acids) and…
A: Introduction : Biomolecules are defined as the organic molecules present in a living cell which…
Q: 2. What link of a contour of biological regulation provides possibility of regulation "on a…
A: Introduction The contour of biological regulation:- It is a way for information processing &…
Q: Why do water-dwelling animals have thicker bones than land-dwelling animals?
A: Bones are the organs of support and form the part of skeletal system. These maintain the body shape…
Q: Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the…
A: Phylogenetic tree is responsible for providing the relationship between the taxons. It also provides…
Q: What are some other prezygotic reproductive barriers besides a mating dance?
A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…
Q: Can simple technique be used to identify more than the morphological characteristics of…
A:
Q: This experiment separates meat into an acetone-soluble part and an acetone-insoluble part. The…
A: Explanation: Meat has a lot of water, which is acetone soluble. Because of this, the experiment's…
Q: Northern blots are valuable tools to analyze the mRNA level present in a sample. Describe an…
A: The goal of a northern blot is to monitor the expression of a particular genome in tissues, organs,…
Q: Construct a cladogram from the data below.
A: A cladogram is also termed "phylograms", these are used to infer the relationship between different…
Q: Suppose you had a sample that contained equal concentrations (in unit of mg/ml) of DNA and a…
A: Deoxyribonucleic acid (DNA) is a polymer composed of two polynucleotide chains that coil around each…
Q: Which arrow in the diagram of transcription below is labeling the 'SENSE DNA strand? Note that the…
A: In genomics, transcription is the process of creating an RNA copy of a gene's DNA sequence. This…
Q: Discuss at least 3 cardiovascular diseases (CVD) risk factors that can be modified. How do factors…
A: Introduction Cardiovascular diseases CVD also called as coronary artery disease is caused due to the…
Q: Answer it. In Seminal Fluid Analysis, what are aspects of semen that are assessed microscopically?
A: Sperm The male gamete that is motile and fertilize female gamete.
Q: Which of the following is true about nucleosides and nucleotides? Choose all that apply. A…
A: Nucleoside consists of a nitrogenous base covalently attached to a sugar. Nucleotide consists of…
Q: Information about Aurelia Strobila. give all the details about this
A: Aurelia is commonly known as moon jellies.It belongs to the class Scyphozoa and phylum Cnidaria.
Q: Bacteria can evolve.
A: Bacteria are the unicellular prokaryotic organisms. They have a short life span and they divide…
Q: Population divergence occurring as a result of females in a species consistently choosing males of a…
A: Population divergence is an evolutionary process by which the population of inbreeding species,…
Q: Should similarities in the DNA sequences of genes be considered evolutionary homology? Explain.
A: According to their shared evolutionary parent, distinct species of animals with similar structure,…
Q: 1. In 3 sheets of bond paper, draw the mitosis, meiosis 1 and meiosis 2. 2. Fold each sheet into…
A: A cell divides into two genetically identical daughter cells during the process of mitosis. Meiosis…
Q: Explain the metabolic processes in cyanobacteria (glycolysis, krebs cycle, electron transport chain…
A: Cyanobacteria are bacteria that are able to photosynthesize. They are an important group of…
Q: C -B اصليين انا A
A: Some cells, such as unicellular bacteria and protozoa, are complete creatures; others, such as…
Q: In endocrine signalling Only nearby cells are affected by the hormone Steroid based hormones are…
A: Signalling:- cell signalling may be categorised into various categories such as endocrine,…
Q: What makes an experiment controlled?
A: Scientists test their hypotheses using controlled experiments. A hypothesis is an assumption, an…
Q: Discuss the three ways by which natural products can be developed and utilized as drugs. which is…
A: Nutrients are substances that are required by the body for nourishment and growth. Depending upon…
Remove codons 24 to 66, inclusive
AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCGGCUUUUUCUAUACCAGAAGGGAGGAUUUGCAAGUUGGCCAAGAAUUAGGCGGCGGUCCCGGGGCGGGGAGUCUUCAACCAAGUCUGCAAAAACGGGGCAUUGUUGAACAAUGUUGUACCAGUAUUUGCAGUCUCUACCAGUUAGAGAAUUACUGA
Step by step
Solved in 3 steps
- If a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____SPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C A T T A T C T A G AComplete the labels for the following diagram of translation. NOTE: A is the product of this process, B is a protein that recognizes the stop codon, C and D are types of RNA A B C Write your response here... Write your response here... Write your response here... Write your response here...
- Highlight or underline or bold both the start and stop codons asapIf the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third lettermRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- oseg 1su Third Base ne following questions refer to Figure 17.2, a table of codons. Second Base nnn UUC UAU non Tyr UCC UAC UGA Stop dois UGG UUA JOS UCA UAA ne UUG UCG UAG di dois CCU CAU CGU CUC SIH CGC CCC CAC CUA no7 CGA CCA Old CAA CCG CAG CGG AAU AUC JOS USV AGC ACC AAC AUA ACA AAA AGA AUG Met or Start Lys ACG AAG GCU GAU dsy GGC GUC GCC GAC Ala Gly GUA GCA GAA GGA GUG GCG GAG GGG Figure 17.2 A peptide has the sequence NH2-phe-pro-lys-pro-gly-phe-pro-COOH. Which Of the following sequences in the coding strand Of the DNA could equal the code for this peptide? a. 5' GGG-AAA-TTT-AAA-CCC-ACT-GGG b. 5' TTT-CCC-AAA-CCC-GGG-TTT-CC c. 3' AUG-AAA-GGG-TTT-CCC-AAA-GGG d. 3' UUU-CCC-AAA-GGG-UUU-CCC e. 5' TTT-CCC-AAA-GGG-TTT-CCCput a space between each codon5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene