When large genomes are sequenced, which of the following is true? Group of answer choices   The genomes are converted from RNA to cDNA using reverse transcriptase, and then the cDNA is sequenced.   The genomes are fragmented, the DNA fragments are sequenced by any number of methods, and the sequences assembled to provide the original complete genome.   Sanger dideoxy sequencing is never used – instead, only nanopore sequencing is used.   The assembled sequences must have all gaps closed if the genome is to be useful for the research community.

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…

Part A Why are most recombinant human proteins produced in animal or plant hosts instead of bacterial host cells? Bacteria do not process any eukaryotic proteins. Bacterial cells might be harmfull for the researchers. Bacteria might not process all the eukaryotic proteins that might be usefull to process the protein molecule. O Only transgenic eukaryotes are able to process eukaryotic proteins. Submit Request Answer

Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020 (Before the beginning of the class) Name ID Instruction: 1. Print this document (US-letter only) Fill the table below with the appropriate color (see coloring rule) 3. Complete and annotate the drawing in attachment (see page #2). Make sure all the listed terms are present in your final drawing! (graded using 5 randomly selected terms 2. This type of drawing makes only sense for Eukaryotes/Prokaryotes (circle one) because: or The annotation must follow the coloring rule : DNA in BLACK. RNA in RED. Proteins and AAs in GREEN. Complex structures with some DNA and/or RNA and/or Proteins in BLUE. Color Color Color DNA DNA pol III Stop codon RNA RNA polymerase 5'-UTR Peptide Helicase 3'-UTR Leading strand Topoisomerase CDS Lagging strand Ligase RBS Coding strand Primer Ribosome SSU Template strand -10/-35 Box Ribosome LSU 5'/3' ends (all) Transcription start AA-TRNA N-/C- terminal ends…