could you elaborate more on the process of step 2? it isn't explained vey well Get live help whenever you need from online tutors! Try bartleby tutor today >Q SEARCH& ASK AN EXPERTA CHATVx MATH SOLVERAnenzymeis discovered that catalyzes the chemical reaction A team of motivated researchers sets out tostudy the enzyme, which they callhappyase. They find that the kcat for happyase is 600 s and carry out several additional experiments.When [Et] = 20 nM and [SAD] = 40 µM, the reaction velocity, V0, is 9.6µM s. Calculate Km for the substrate-SAD.SAD = HAPPYTranscribed Image Text: SAD = HAPPYExpert SolutionStep 1Enzymes are the biomolecules which acts as catalysts for many biochemical reactions and increases therate of reaction by decreasing the activation energy required for the reaction.Step 2In the given question, the given enzymatic reaction that is catalyzed by enzyme Happyase is:SAD = HAPPYThe given concentration of substrate [SAD] is 40 uM, and enzyme concentration is 20 nM. The Kcat forthe enzyme is 600 /sec. The rate of reaction (Vo) is 9.6 uM/sec. The Km can be calculated as follows:VтахутахTE; ]Vmax[SKm + [SКcat 3D— Кcat x| E, Vтах — 600 x 20 х 10-3 риM/secVmax12 иМ/secVoStep 3Hence, the Km for the substrate SAD is 10 µM.

Michaelis menten constant, Km is the substrate concentration required to produce half maximum…

Answered: When [Et] = 20 nM and [SAD] = 40 µM,…

Science

Biochemistry

When [Et] = 20 nM and [SAD] = 40 µM, the reaction velocity, V0, is 9.6µM s1. Calculate Km for the substrate SAD.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: TOPIC: Genetically Modified Organisms Is this a good thing for the society or not?

A: Genetically modified organisms are type of transgenic animals or organisms in which foreign genes…

Q: How is a cancer cell different from a “normal" cell? O A cancer cell divides, and a normal cell does…

A: How is a cancer cell different from a "normal cell" ? A. A cancer cell divides, and a normal cell…

Q: 1x104. Student 1 claimed that the virus caused the bacteria to to become resistant, while student 2…

A: Virus or bacteriophage infection in E. coli will initially result in death of the bacterial cells.…

Q: is DNA is ONLY found in 100 cells of our body.

A: DNA also known as Deoxyribonucleic acid which carry genetic material for the development of…

Q: 2. *REQUIRED 1 A somatic cell in an organism develops a DNA mutation. This mutation is a beneficial…

A: The genetic traits are those which are transferred from parents to their offspring. Heritable traits…

Q: 3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay…

A: Transcription One of the initial steps in gene expression is this procedure. The transport of…

Q: O O O DNA. a neuron. skin. E. coli.

A: Although necessary for living entities to carry out their cellular functions, DNA is a chemical and…

Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)

A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…

Q: What caused some bedbugs in the population to develop tough-skin? gene studies J gene deletions O…

A: In a population of individuals of the the same species, individuals slightly vary from one another…

Q: Which of the following is a significant difference between DNA and RNA? their main location in the…

A: Step 1 :- answer - No correct response Deoxyribonucleic acid is a double stranded helical molecule…

Q: you want create a clone of that particular person using those isolated cells.will you succeed? if…

A: Molecular cloning or simply cloning means a process of producing copies of DNA fragments or cells in…

Q: Which statement about polymerase chain reaction (PCR) is correct? O The PCR primers are made of RNA…

A: Polymerase Chain Reaction is the in vitro application of the process of DNA replication that is done…

Q: Changes in genes that cause new traits are called mutations alleles DNA chromosomes

A: Genes are the basic working unit of genetic inheritance. They are short segments of DNA that contain…

Q: All mutations are passed on to the next generation. True False

A: The segments of DNA that code for traits are called genes, which have specific nucleotide sequences.…

Q: why do we use chimera for possible organ transplantation? Why not use only pig or monkey as their…

A: Chimera is an organism or tissue that contains at least two different sets of DNA, most often…

Q: Asap

A: Clinical trials or human experimentation is conducted by physicians or researchers mainly to attain…

Q: e. None of these 8. An earthquake hits the bay area, and you and your family have the choice of…

A: Introduction:- Any sudden shaking of the ground generated by seismic waves passing through the…

Q: Is Gene Theraphy interfering God's plan to people?

A: Gene therapy aims to change or manipulate a gene's expression or biological features of live cells…

Q: 3. Why will we put your cheek cells in the InstaGene solution? In other words, why do we want to…

A: DNA isolation is one of the crucial steps in molecular biology and should be performed with care and…

Q: O the deer died the cactus with the thorns is damaged the cactus without the thorns is damaged O the…

A: Plants show different kind of adaptations so as to get acclimatize to their environment. The…

Q: What are cells that have been made ready for transformation by exposure to chemicals called? O…

A: Bacteria is the unicellular organisms they are different types of bacteria many lives in different…

Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…

A: As stem cells are the cells which have the ability to divide and can give rise to many different…

Q: Can you please do question 9,10, and 11

A: Hey, since there are multiple questions posted, we are answering the first one. If you want any…

Q: Choose a reproductive biotechnology explain the basic process that is used, and, using à felevant…

A: Reproductive Biotechnology : It encompasses all current and anticipated uses of technology in human…

Q: Which of the following is true about a merozygote? conjugation with an Hfr donor will never produce…

A: Merozygote is a state of a bacterial cell being temporarily partial diploid as a result of the DNA…

Q: t your physician sunpects you have symptoms of a genetic disease, he can colect cells for genetic…

A: INTRODUCTION Answer of question 4 is given below.

Q: Before the cell divides, 2 DNA strands must be available so that genetic information can be passed…

A: DNA replication is the process by which DNA makes a copy of itself during cell division.

Q: 5. Molecular Evidence. Cytochrome c is a protein located in the mitochondria of cells involved with…

A: Introduction : DNA and RNA are the two types of genetic material that are present in every organism,…

Q: He gets a "reject" result on his hypothesis test. What conclusion should he draw? o There is enough…

A: There is enough evidence to believe that red meat causes cancer.

Q: 6. _____ is a DNA sequence. 1.Coactivator 2.Corepressor 3.Enhancer 4. Inducer…

A: Deoxyribonucleic acid or DNA is a genetic material present in each and every individual that…

Q: 3. in asexual reprodution, what is passed from the original cell to its offspring? RNA genotype…

A: Reproduction is the fundamental biological process of generating the offspring in the next…

Q: Genetic mutations are permanent. Do you agree or disagree?

A: The mutation is a change in the sequence of genetic material caused by a mistake in replication or…

Q: 1. How many TSS sites were identified using this technique? 2. Look at the labels next to each of…

A: The precise nucleotide position in a DNA or RNA sequence where the translation of an mRNA molecule…

Q: What happens immediately following uncoating of a minus strand RNAvirus? O Transcription of MRNA…

A: This is majorly found in some viruses , where uncoating is found that means genome is completely…

Q: Create a script about genetic manipulation on animals and plants. All contents of the video must be…

A: Genetic engineering is the manipulation of DNA inside a gene to alter a life form's qualities and…

Q: DNA replication is semi-conservative and results in each new cell receiving a copy composed of 1 new…

A: DNA or deoxyribonucleic acid is the biomolecule that carries the genetic information in a coded form…

Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…

A: Transcription and translation are terms used to describe two distinct biological processes: the…

Q: 2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual…

A: Muscular dystrophy It is a genetic disorder, in this disease the muscle of the individual weakens.…

Q: If a fish does not produce activator 1 proteins because of a mutation in the gene that encodes those…

A: By activating particular genes, activator 1 proteins regulate the expression of genes. Activator 1…

Q: Initially, she may present her data and condusions at a scientific conference whe tists. Later, she…

A: Science is the coolest subject that revolves around every testable and prediction around the world.…

Q: Please answer the recent examples or studies about cloning entire organisms in 1. Plants 2. Animals

A: Cloning is a laboratory procedure that creates genetically identical organisms via non-sexual ways.…

Q: Cells are producing protein from every gene they have all the time True False

A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome…

Q: following is an example of epistasis?

A: Epistatis: It is defined as the the action of masking one gene upon expression of another gene. Even…

Q: What is the scientific method involved and risk assessment in an experiment testing the tongue of…

A: The scientific method is a systematic approach used by scientists to investigate phenomena, test…

Question

100%

could you elaborate more on the process of step 2? it isn't explained vey well

Get live help whenever you need from online tutors! Try bartleby tutor today >
Q SEARCH
& ASK AN EXPERT
A CHAT
Vx MATH SOLVER
An
enzyme
is discovered that catalyzes the chemical reaction A team of motivated researchers sets out to
study the enzyme, which they call
happyase. They find that the kcat for happyase is 600 s and carry out several additional experiments.
When [Et] = 20 nM and [SAD] = 40 µM, the reaction velocity, V0, is 9.6µM s. Calculate Km for the substrate
-
SAD.
SAD = HAPPY
Transcribed Image Text: SAD = HAPPY
Expert Solution
Step 1
Enzymes are the biomolecules which acts as catalysts for many biochemical reactions and increases the
rate of reaction by decreasing the activation energy required for the reaction.
Step 2
In the given question, the given enzymatic reaction that is catalyzed by enzyme Happyase is:
SAD = HAPPY
The given concentration of substrate [SAD] is 40 uM, and enzyme concentration is 20 nM. The Kcat for
the enzyme is 600 /sec. The rate of reaction (Vo) is 9.6 uM/sec. The Km can be calculated as follows:
Vтахутах
TE; ]
Vmax[S
Km + [S
Кcat 3D
— Кcat x| E, Vтах — 600 x 20 х 10-3 риM/secVmax
12 иМ/secVo
Step 3
Hence, the Km for the substrate SAD is 10 µM.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

If your nerve cells and skin cells have exactly the same genes, how can they be so different in their function?
If Avery, MacLeod, and McCarty had determined that the transforming molecule was RNA, what experimental results would have been observed? O S cell DNA extracts treated with RNase would lyse the nucleus O S cell DNA extracts treated with RNase would not transform the R cells S cell DNA extracts treated with DNase would not transform the R cells O S cell DNA extracts would not transform the R cells at all O none of the answers are correct
Transgenic (GMO) Tomatoes The use of pesticides to control insects costs billions of dollars every year. Genetically modified organisms (GMOS) are an attempt to reduce this cost. Tomato plants that are genetically modified can make proteins that are poisonous to the insects that feed on them. Using these GMO tomatoes would reduce the need for the chemical control of insects. 1. State one possible advantage of having tomato plants that make proteins that are poisonous to insects. 2. In biology, a trade-off exists when one trait cannot increase without a decrease in another. What trade-offs exist in the creation of transgenic tomatoes? 3. Question Answer 28. Some farmers currently grow genetically engineered crops. An argument against the use of this technology is that 1) it increases crop production 2) it produces insect-resistant plants 3) its long-term effocts on humans are still being investigated 4) it always results in crops that do not taste good
. I 1 I 2 I 3. I 4. I 5. L . Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TIT ATG GAC TCT ACG GAC TAA CCC CCG TTT 3' 1. Synthesize a piece of DNA to complement the template: 2. Using the given DNA template synthesize the MRNA: 3. What is the amino acid sequence of this protein? Good to go O Focus
9. The transfer of genetic information from a mother cell to the daughter cell is an example of horizontal gene transfer. True or False.
Part 2 Bio Question 4
2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'-TACCATGAGAATTGTGG TCACCTTITT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
Send me 5 research articles releated to stem cell therapy in animals .
cell's genome O contains all of a cell's DNA. O is defined as all the genes being used to make protein. constantly changes, depending upon the cell's environment. is altered during embryonic development
If a change in a DNA sequence occurred, could that affect the mRNA? Why or why not? Group of answer choices 1. no because the mRNA is not identical to the DNA 2. no because the mRNA does not need the DNA to be made 3. yes because the mRNA is made using the DNA as a template 4. yes because the mRNA is identical to the DNA
I would like to know a list of examples on different human diseases that has a genetic basis and can be investigated using model organisms. Thank you!
1.Outside of a random mutation, the prion that causes Mad Cow was probably passed to other cows via Group of answer choices Hormones Lack of light in factories Cows having to eat other cows