what type of cells possess unlimited proliferation potential and have the capacity to self renew, and can give rise to all cells within an organism?
Q: Why is it more difficult to determine the sex of a newlyhatched canary than a newborn puppy?
A: A sex-determination mechanism is a physiological system that controls how an organism's sexual…
Q: Which type of point mutation does not affect the resulting protein? a deletion b missense mutation…
A: A mutation is any alteration or change in the sequence of the genetic material (DNA or RNA). A point…
Q: Question 7. What is the rate-limiting step in the formation of an actin microfilament or a…
A: Actin and myosin are muscle protein. These proteins play important role in the formation of cell…
Q: Cell membranes can maintain a difference in electrical charge between the inte- rior of the cell and…
A: Introduction The plasma membrane or cell membrane is the outer layer of all cells, however it is…
Q: How can thinking of Earth as an island help us in the quest for a sustainable future?
A: Answer :- As we know that The earth is like an island. It is a shut framework with repsect to issue.…
Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…
A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…
Q: A. Complete the table below by filling in the information you have learned from the concept on the…
A: Cell is the structural and functional unit of life. Cell can be prokaryotic (without nucleus) or…
Q: how enzymes are involved with proofreading newly formed DNA molecules. 1. DNA polymerase does not…
A: In proofreading process, The polymerase checks whether the recently added base has matched…
Q: You are doing experiments in a lab to test a potential new drug (you are calling it “relaxomere”)…
A: experiments in a lab to test a potential new drug for “relaxomere” for the treatment of…
Q: Describe the Ti plasmid binary vector system usee in plant transformation and provide details of how…
A:
Q: Synthesis phase in the cell cycle is called so, because of the synthesis of more: A. RNA B. RNA and…
A: A cell cycle is considered as a set of events and these events take place in the cell and the cell…
Q: SARS-CoV-2 spreads through cell-to-cell transmission
A: Introduction Covid 19 is a coronavirus-caused acute respiratory infection in humans that can cause…
Q: Why is oxygen needed for cellular respiration to occur (what is its role at the mitochondrial…
A: Cellular respiration is the metabolic process that takes place in the mitochondria of cells. It…
Q: Synthesis phase in the cell cycle is called so, because of the synthesis of more: A. RNA B. RNA and…
A: Introduction - A cell cycle is a series of events that occur in a cell as it divides and expands.…
Q: hat features of molluscs appear in other invertebrate phyla? Explain
A: The most common properties of mollusks are covers with various vital openings used for breathing and…
Q: What makes molluscs different from other invertebrate phyla?
A: Introduction Molluscs:- Mollusca is the second-largest phylum of invertebrate animals after the…
Q: Choose a specific process in food businesses that allow them to get rid of/prevent the growth of…
A: Food preservation procedures include those that limit the growth of germs like yeasts (although…
Q: Genetic Crosses that Involve 2 Traits In rabbits, black hair is dominant to brown hair. Also in…
A: The Punnett square is a square design which is utilised to forecast genotypes in a cross or breeding…
Q: give examples of 4 different values of hematocrit and explain their meaning
A: Hematocrit is a measure of the percentage of red blood cells in the body. if a person has 50…
Q: Which do you think is more effective strategy for biodiversity conservation, Maintaining a Single…
A: The term biodiversity refers to the variety of life on Earth at all its levels, from genes to…
Q: why is it important to name organisms? Prionance glauca is sometimes referred to as the blue whaler…
A: Introduction :- A group of living organisms made up of similar individuals capable of interbreeding…
Q: Colonies that produce alkaline waste on Hektoen enteric agar will turn O blue-green. O pink. O…
A: Colonies that produce alkaline waste on Hektoen enteric agar will turn blue- green.
Q: Male premature ejaculation and female orgasmic disorder are examples of orgasm problems. Compare…
A: Answer :: Male Premature ejaculation Sexual arousal can be described as a state of being aroused to…
Q: Match the phases of meiosis with their descriptions. Question 6 options: chromatids of…
A: Meiosis It is a kind of cell division in which four daughter cells are form and each cell has half…
Q: When comparing Gastropoda with bivalvia, is the relationship monophyletic, polyphyletic, or…
A: Mollusks are soft-bodied animals and the body is divisible into visceral mass and foot. The visceral…
Q: 1. In fetal hemoglobin, residue 143 of the beta subunit is a serine rather than the histidine found…
A: Fetal hemoglobin, also known as fetal hemoglobin, is the main oxygen carrier protein in the human…
Q: the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate the hosts (talk…
A:
Q: Monosaccharides enter central meta O Glyoxylate shunt O Oxidative phosphorylation O Glycolysis O…
A: Ans- the correct answer for the above question is- D) OXIDATIVE PHOSPHORYLATION TCA CYCLE. Central…
Q: Match the human development with the week or month of development. Question 30 options: skull,…
A: Once the fertilization occurs the resulting zygote moves to the uterus there it gets adhered to the…
Q: Select all that are true about DNA gel electrophoresis O This technique can be used to separate DNA…
A: The gel electrophoresis is routinely used technique in molecular biology laboratories that helps in…
Q: 1. When you simply look at the banding patterns on the gel from the DNA fingerprint we ran in lab as…
A: Gel electrophoresis is a molecular biology technique that is used commonly after DNA isolation to…
Q: You've discovered a new organism that contains a mutant form of Hemoglobin (red line on right) and…
A: The heamoglobin binds the oxygen molecules and flow it through the whole body . The bind of oxygen…
Q: f. If Lamarck and Darwin had debated why giraffes have such long necks, how would their explanations…
A: Lamarck He proposed the theory that the physical changes in organisms that took place during their…
Q: True or False: 1. Lytic viruses utilize the host’s machines to construct their viral components…
A: The term 'virus' is derived from the same word in Latin, meaning venom or poisonous fluid. It was…
Q: Distinguish between the main groups of archaea and identify specific types of archaea belonging to…
A: Archaebacteria are the oldest living organisms belonging to kingdom Monera and are classified as…
Q: b. Describe the function of each set of bones in Table 1. (Ex. human - picking up objects) c. Are…
A: Homologous organs are those that are structurally similar but differ in their functioning and…
Q: What if the continents did not move, how could you explain disjunct distributions?
A: Introduction A taxon with a disjunct distribution is one that has two or more groups that are…
Q: What is ADP phosphorylation? What respectively are photophosphorylation and oxidative…
A: Introduction - The addition of phosphate to an organic substance is known as phosphorylation.…
Q: C4 pathway is included in the process. O Light Reaction O Calvin Cycle O Both Light Reaction and…
A: Correct answer is option 4. C4 cycle is an alternate mode of CO2 fixation have evolved in many…
Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…
Q: 1. In what organelles is plant DNA located? 2. What molecules or structures are present in cell that…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Match the description with the type of evidence of evolution they belong to. 1. Homologous…
A: Evolution is the change over time. It is the unifying theory of biological science. There are many…
Q: Why the synergy test results demonstrated that Penicillin G and Gentamicin did not act…
A: Penicillin G is an antibiotic that is used to treat bacterial infections. Pneumonia, strep throat,…
Q: Match the artificial conception methods with their descriptions. Question 23 options: donor…
A: Fertilization: Fertilization, also known as syngamy and impregnation (note spelling changes), is the…
Q: Match the different types of Mendelian genetics with their descriptions. Question 1 options:…
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: In a species the haploid number of chromosomes is 4. Independent assortment has the possibility of…
A: Two single chromosome divide gene or chromosome pair. As a result two single haploid chromosome…
Q: True or False: Plant viruses like animal viruses also utilize the cell’s machines to create viral…
A: NADP and ATP are utilized along with the carbon dioxide by plants. Later, the production of glucose…
Q: vill regulate the physiological activities to make the conditions normal. Use the organs ssibly…
A: Hypothalamus in the brain plays a very important role in controlling and regulating the body…
Q: Insects are capable of fairly advanced behavior. e and briefly explain an example of advanced insect…
A: Insects are invertebrates belonging to the phylum Arthropoda and class Insecta. they are the largest…
Q: one: A 45 years old male who is a participant in a new medicine trial that blocks the renal tubule…
A: Urine is mainly formed in the nephrons of the kidney. Nephron is the smallest unit of excretion.…
what type of cells possess unlimited proliferation potential and have the capacity to self renew, and can give rise to all cells within an organism?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The end result of mitosis and cytokinesis is A) two cells, each with half the number of chromosomes as the mother cell B) three cells, one of which is twice the size of the other two C) two cells identical in size and genetic material D) two cells identical in genetic material, but one is smaller than the otherWhich is true for cancer cells: 1) Cell death occurs after a determined number of cell divisions 2) Contact with other cells reduces chance of cell division 3) Cell division occurs in the presence of stop signals.When some cancer cells produce growth factors that stimulate their own division leading to continuous self- stimulation for cell division it is referred to as a) TNF tumor necrosis factor b) AGS autocrine growth stimulation
- Even though cytokinesis is included with Mitosis, we generally consider it to be its own phase. Why? by the time cytokinesis occurs, the cell has already split by the time cytokinesis occurs, the cytoplasm has already split by the time cytokinesis occurs, the nucleus has already split by the time cytokinesis occurs, the cell has copied all of its chromosomesWhy can cells not grow to unlimited size?Why is cell furrowing important in cell division? If cytokinesis did not occur, what would be the end result?
- Which of the following statements about cell division and cells is true? a) Adults have much larger cells than children, and adults have many more cells than children. b) Adults and children have cells that are about the same size, and both children and adults have about the same number of cells. c) Adults and children have cells that are about the same size, but adults have many more cells than children. d) Adults have much larger cells than children, but both children and adults have about the same number of cells.why is it important for cells to maintain a smaller size?Which types of cells are easier to replace, and thus can be found in places like our mouth and outer skin where we lose cells a lot?
- The cell division process that cells in culture undergo includes the following stages in temporal order: O a) Telophase, anaphase, prophase, metaphase O b) Anaphase, metaphase, prophase, telophase O c) Metaphase, prophase, telophase, anaphase O d) Prophase, metaphase, anaphase, telophaseExplain the process of Cell proliferation ?Describe how growth factors trigger cell division.