What region would provide cell type-specific expression of genes? region  What site would significantly increase gene expression rates? = region  What region or regions of this gene’s coding sequence are expressed as amino acids = region

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. mRNA 20 ORI 40 60 3' GATATTACTGGI АAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAG TTCGAGCTCTCGTCGTCGAGATACGCGATGAT GGTAATATGGGATGCACTATC 5' promoter RNA polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'…

Choose the statement that correctly characterizes regulated and/or constitutive gene expression. Regulated expression refers to gene expression that is either on or off, depending on the physiological or metabolic status of the cell. Constitutive expression refers to gene expression that is either on or off, depending on the physiological or metabolic status of the cell. Constitutive expression refers to gene expression that is always repressed in response to the absence of required nutrients or other metabolic molecules. Regulated expression refers to gene expression that is always on, regardless of the metabolic or physiological conditions in the cell. Regulated and constitutive expression are terms used to describe gene expression in prokaryotes only.

Refer to the following illustration to answer the question. O protein A is not made because it is normally required for its own transcription TRANSIENT SIGNAL TURNS ON EXPRESSION OF PROTEIN A What is protein A? O a maintenance methyltransferase O a histone PAY O a cell type-specific gene regulator a HAT (histone acetyltransferase) any of the above PAD the effect of the transient signal is remembered in all of the cell's descendants

Choose ONE example of control of gene expression in eukaryotes and describe it in detail. Identify which of the five levels of regulation of gene expression your example represents and explain how your example benefits the cell in which it takes place.

A gene in a eukaryotic cell is not being expressed but there is no mutation in its DNA sequence. In your own words using complete sentences give a plausible explanation as to why the gene is not being expressed using one of the concepts discussed in class. You must fully explain what is happening to cause the gene not to be expressed. You will be graded on grammar, content and thoroughness of your answer.

In cancerous cells, CpG islands are:   where intercalating agents are found   demethylated methylated

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGAТАТТАСТGGТААТАТСGGGАTGCAСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||

Discuss how the differential gene expression is possible when all somatic cells carry identical genes and genome.