What is the FIBROUS PROTEIN as the classification of proteins based on shape or conformation

Please don't provide handwriting solution

What does the “=“ mean when used in a macromolecule when written out.

Amino Acid Sequence:

How ribosomes cannot do it's normal job in treacher Collins Syndrome disorder Please write it in a summarized/simple way. And include it in bullet points. Thank you so much

I’m not sure which answer is correct for this question can you please help?

Which of the following does cytosine pair with? Please select all that apply. No partial credit. adenine guanine cytosine thymine uracil

Please type answer no write by hend.

Sort the images according to the level of structure in the proteins shown. Sort the items into the appropriate bin. ▸ View Available Hint(s) Reset Help Primary structure Secondary structure Tertiary structure Quaternary structure Mis

How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa   Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…