What is the condition forMendel’s second law to bevalid?

Q: explain thigmotropism?

A: Thigmotropism means, moving with help of touch. Where, thigmo = touch, and tropism = tendency of an…

Q: Outline the wobble rules.

A: The Wobble Hypothesis proposed by Francis Crick, states that the 3rd base in an mRNA codon can…

Q: Which organism cause kala-azar in humans?

A: Visceral leishmaniasis is commonly referred to as kala-azar. It is caused by the protozoan parasites…

Q: If a hapten conjugates with a carrier molecule, what might the result be?

A: Hapten is a small molecule which can be a protein or carbohydrate anything foreign to the body and…

Q: What is a homeodomain protein?

A: Homeodomain proteins belong to the large family of transcription factors. They have conserved 60…

Q: What are the differences in terms of structure and ligand-binding interactions? What are the…

A: GPCRs are a type of transmembrane receptor that consists of seven transmembrane helices that…

Q: Outline the flow of electrons from succinate to Ubiquinone through complex 2:

A: Complex 2 of the electron transport chain is a complex which does not pump any protons. Complex 2 is…

Q: Write a backgrounder of mental illness due to covid-19?

A: The COVID-19 pandemic, which emerged in late 2019 and continued to affect communities globally, has…

Q: What are paralogous tubulin proteins?

A: Introduction  Tubulins are the fibrous proteins which plays an important role in cell division. They…

Q: What is the correct order from simple to complex ?

A: In short, Simple form are basic.  Complex form is combination of simple systems.

Q: What is a morula, and how is it formed?

A: Embryonic development or embryogenesis is the development of embryo from fertilized egg and its…

Q: What is a gemmule?

A: Sponges are the members of the phylum Porifera. Sponges are a multicellular organism that has bodies…

Q: Explain Poiseuille’s Law with example?

A: A statement in physics: the velocity of a fluid's steady flow through a narrow tube (as a blood…

Q: Name the base change and aminoacid change,responisble for sickle-cell anemmia?

A: Sickle cell anemia is a genetic disorder in which the hemoglobin is structurally deformed.

Q: What is fixism?

A: Introduction When it comes to Earth's biodiversity, fixism holds that the current species in…

Q: Define nonelectrolyte

A: Body fluid contains electrolytes, electrolytes are chemicals which, when they dissolve in aqueous…

Q: Define polytenization.

A: The genetic material that is responsible for carrying genetic information from one generation to…

Q: Why was an oxonium ion expected to be involved in the lysozyme reaction?

A: Lysozyme is a naturally occurring enzyme which is found in bodily secretions such as tears, saliva,…

Q: What is the structure labeled A in the above picture and what the two functions of label A.

A: The given diagram is frog dissection. The scientific name of the frog is Rana tigrina.

Q: Hemoglobin is composed of how many  polypeptide chains thatchange during development?

A: Hemoglobin is an oxygen-binding protein present in RBCs that helps in the transportation of oxygen…

Q: What do the designations F+, F−, F′, and Hfr mean?

A: A plasmid is an extracellular, double-stranded, circular Deoxyribonucleic acid present in an…

Q: Explain Lesch- Nyhan Syndrome ?

A: It is a rare inborn error for purine metabolism, characterized by the absence or deficiency of the…

Q: Identify the type of structural conformation found within the botulinum toxin molecule.

A: Clostridium botulinum produces the botulinum neurotoxin.

Q: What are monocistronic with examples?

A: Monocistronic is where there is only one gene expressed from a promotor region on a piece of DNA so…

Q: Where do euglenoids occur?

A: Algae are significant because they are the primary producers of biomass in the aquatic ecosystems.…

Q: what is Interrupted mating in bacteria?

A: The process by which a bacterium transfers its genetic material to another bacterium through direct…

Q: What is the fate of ubiquinol generated by Complexes I and II?

A: The third step of cellular respiration i.e. oxidative phosphorylation which deals with the transfer…

Q: How is the table solved?

A: As you can see here Total no of species introduced and total annual economic costs are given. Along…

Q: What is biological term for product of fusion.

A: Reproduction is an essential feature of all living organisms. It is the ability of an organism to…

Q: What is mitochondrial DNA and how is it inherited?

A: Mitochondria are organs that present within eukaryotic cells. It performs vital functions such as…

Q: Name two common enzymes that function toincorporate NH3 into the cell. How do their…

A: Ammonia (NH3) is a colorless soluble gas used in making explosives, fertilizers, and some cleaning…

Q: Considering that we are all made up of the same 4 nucleotides in our DNA, the same 4 nucleotides in…

A: The question is at the heart of genetics and molecular science. Despite sharing the same basic…

Q: Describe the structural and functional properties of thenuclear pore complex.

A: The fusion of inner and outer nuclear membrane results in the formation of nuclear pores in the…

Q: What is the differencebetween homozygosity andheterozygosity?

A: The alternate forms of gene are referred to as allele. An allele determines the hereditary…

Q: What is the most common mitochondrial disease?

A: Mitochondria are cell organelles within eukaryotic cells, which produce adenosine triphosphate…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Describe Poiseuille’s law?

A: Non ideal fluid dynamics is defined as a branch of fluid dynamics where it helps in understanding…

Q: Is there a reason why you divided the pKa's by 2 when determining the pI?

A: Isoelectric pH or pI is the pH at which the amino acid or the peptide is in zwitterion state.…

Clinical Pharmacology

Pharmacology is a discipline of medicine that studies how medications interact with the systems and processes of living organisms, focusing on drug action mechanisms as well as therapeutic and other purposes.