C6H1206+ 602+ ADP + Pi 6CO2+ 6H20 + molecule A

Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000 (include the comma)

35

Are these true or false answers correct? If so, what is the proper word to replace the underlined words, for the false.

A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e.  indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl

Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation

Q3. Cystic fibrosis is an autosomal recessive inherited disorder that causes severe damage to the lungs, digestive system and other organs in the body. Cystic fibrosis affects the cells that produce mucus, sweat and digestive juices. The disease occurs when there is a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which is the gene responsible for the movements of negatively charged particles known as chloride ions into and out of cells. Using the base pairing rules and the codon table, determine the mRNA and protein sequences produced by the CFTR gene's segment (below). Transeription begins at and includes the bold and underlined G nucleotide. CFTR gene's segment. - GCGATGTACAACCGAGGGTAAAAAA - 3' coding sequence a) The DNA template sequence 3'.. ...5' b) Fill in the first 9 nucleotides of the primary/ nascent mRNA transcribed from Gene A. 5'-.... -3' c) Protein N-term... . . C- terminus d) Exposure to cigarette smoke (a known mutagen) deletes base #9…

Define the following terms: a. guanine nucleotide exchange factor (GEF) b. pretranslocation state c. posttranslocation state d. nascent polypeptide e. releasing factors

What are Okazaki fragments? Why are they formed?

Please determine the order of aminoacids from a given genetic code? 5’-UGGUACGGUACUCCAC-3’