Q: QUESTION 8 The mating below shows the sex chromosome found in two parents and their resulting…
A: The fragile X mental retardation protein is encoded by FMR1, which is found on the X-chromosome…
Q: The biggest obstacle in the acceptance and development ofthe science of microbiology was the(a) Lack…
A: Introduction Microbiology is the scientific study of unicellular, multicellular, and acellular…
Q: Fill in the negative homeostatic feedback loop to determine how your body will respond hormonally to…
A: Blood pressure is the blood circulation pressure against the sides of the blood vessels. The bulk of…
Q: 30-40% of all type 1 DM patients develop nephropathy in years
A: Diabetes can cause diabetic neuropathy, which is a kind of nerve injury. High blood sugar (glucose)…
Q: Albinism is homozygous recessive (aa). A sister with normal coloration has a sister that has…
A: Albinism is a disorder of autosomal recessive inheritance. Albinism inhibits melanin production,…
Q: Methods of determining the variety and abundance of life forms (species assemblage and dominants) in…
A: Species diversity represents the the number and abundance of total species in a particular…
Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…
A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…
Q: Jay has been suffering from diarrhea for the last 3 days what do you think has happened to his…
A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…
Q: 8. If the molecular weight of E. coli DNA is taken as 2.7 x 10° and the average molecular weight of…
A: Every organism's DNA is a source of genetic material. It is made up of two strands that run…
Q: CLASSIFICATION EXAMPLES FEATURES Domain Archaea Kingdom Phylum Class Order Family Genus Species…
A: Classificiation can be defined as a arrangemant of taxa on the basis of certain observed…
Q: 1. How do animals reproduce? 2. How do humans reproduce? 3. How can the use of hydroponics help…
A: Reproduction is the process by which organisms make more organisms like themselves. But even though…
Q: If an embryo splits at the two-cell stage, each of the resulting identical twins will have its own…
A: Identical twins: The splitting up of the embryos into two at the two-cell stage leads to the…
Q: Based on your understanding of skeletal muscle fiber physiology, which of the following processes is…
A: ATP is the adenine tri phosphate and is the instant source of energy .It is used in many of the…
Q: is this true or false?
A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes."…
Q: The probability of having an individual recessive for all gene pairs from the cross Aabb x aaBb is O…
A: This is a case of dihybrid cross because there are involved two genes. These genes are A and B.
Q: 4. In owl, barring (B) is sex-linked and dominant, the recessive allele (b) producing solid black…
A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…
Q: In which site(s) of the ribosome could you find a tRNA with more than one amino acid bound (a…
A: Introduction :- The peptidyl transferase is an aminoacyltransferase and the principal enzymatic…
Q: Gestation takes about -____weeks. a) 38-42 b) 44-46 c) 28-30 O d) 48-52
A:
Q: How is viruses and protozoans can cause pathogenesis that is different from bacteria?
A: As we know that that the pathogen is disease causing organisms and can cause infection and…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: chromosomes will there be in the cells at the When, during the life of an organism, would you expect…
A:
Q: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…
A: Question - What is biology? A) The study of DNA. B) The study of the environment. C) The study of…
Q: 21. Which of the following species, either presently or formerly listed as endangered or threatened,…
A: Otters rarely attack humans, but can sometimes be territorial, especially when they are protecting…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A:
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: What makes the cell wall of Listeria monocytogenes interesting in this regard?
A: Listeria monocytogenes (Lm) is a major intracellular foodborne bacterial pathogen that causes…
Q: The bond is found in protein and linked the amino acid is
A:
Q: Which of the following is NOT a catalytic strategy used by trypsin? a. Acid-base catalysis b.…
A: Enzymes require an ideal pH range and temperature to operate properly. The tertiary structure of the…
Q: Homing and navigation in salmon (across developmental stages; e.g., from stream to ocean and back to…
A: Homing in migrating fishes, such as salmon, can be defined as a behavioral pattern in which an…
Q: How does a bilateral symmetry and an orthogonal nervous system design contribute to reproductive…
A: Introduction Bilateral Symmetry is a basic body plan in which the organism's left and right sides…
Q: A condition wherein the presence of a certain allele causes death of the organism. O lethal genes O…
A: a condition wherein the presence of a certain allele causes death of the organism is called lethal…
Q: Zika virus infection, a zoonotic disease, produced somewhat sizable outbreaks recently in certain…
A: To explain: To explain about Zika virus infection and dichotomy
Q: 9. Coronary arteries route oxygen leH of the: d. descending aorta halpern round-a-bout a.…
A: Coronary artery supplies the fresh blood to the heart wall. It is of following types-Left anterior…
Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…
A: Metalloprotein linkages are most likely to be formed between?
Q: A survey on the trait: Free and Attached earlobes.The allele for free-hanging earlobes is F.while…
A: We have, Total number of students - 600 Number of students with attached earlobe (recessive) - 278…
Q: abel the muscles on the dorsal and ventral sides of the frog. 1 2 10 3 11 12 13 14 15 8 16
A: Frog muscles: In frogs different types of muscles can be found that help the frog in performing…
Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…
A: Gnathostomulids is the marine worm while rotifers are multicellular organism.
Q: osmoregulation homeostasis
A: Introduction Homeostasis:- It is an organism's physiological capacity to maintain a constant…
Q: Organism Characteristic A В E Morphology Rod Rod Coccus Coccus Rod Motile Yes Yes No No Yes Gram…
A: Please follow step 2 for detailed explanation.
Q: Figure 3: /Zea mays/ Shoot tip 7 12 11 10 8 For questions 7-12, refer to Figure 3. Identify the…
A: In Zea mays the apical meristem is also known as the growing tip. It is undifferentiated…
Q: Calcitonin is enzyme that functions to reduce blood calcium levels True O False CK may be derived…
A: Storage lipids, also known as triacylglycerols, membrane lipids, which include glycerophospholipids…
Q: All of the following could be deduced from the table except CRITERIA MITOSIS MEIOSIS 1. No. of…
A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…
Q: Why are new drugs for heptacellular carcinoma necessary? Highlight: - that the risk factors for…
A: Hepatocellular carcinoma or the liver cancer can be treated by several drugs. Moreover, every cancer…
Q: 3. Explain and elaborate what is the respiratory system and circulatory system. Give its…
A: Respiratory system The respiratory system is crucial to every human being. Without it, we would…
Q: If a phage is undergoing lytic growth, which protein is bound to the operator region? O Both Lambda…
A: In this Particular question we have to describe about regulation of lytic cycle.
Q: To relate: "The evolution of natural selection and the evolution of features that reduces the…
A: Natural selection is defined as the physical and reproductive fitness of a species in changing…
Q: Calcitonin is enzyme that functions to reduce blood calcium levels
A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…
Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: QUESTION 6 You are a clinical geneticist and have a patient that is phenotypically female and has…
A: Mutation refers to both the process of altering a gene or chromosome and the outcome of that…
Q: In light and dark forests, What impact do you think the environment has in the peppered moth…
A: Their population increased while the population of the moths that were white with black spots…
Step by step
Solved in 3 steps
- In family function assessment, cultural practices are critical. Is it necessary to consider culture during the assessment phase? Correct or Incorrect. Give an explanation for your answer.How is coding for mental, behavioral, and neurodevelopmental disorders different from other specialties? Why is this type of coding challenging?Explain thoroughly from a medical perspective. What is the chain of custody?