What explains why some species are polygynous, some polyandrous, and some monogamous? Name the term, describe what it means, and give one example to help explain your answer.
Q: How would you determine the sugar-binding specificity of any isolated lectin?
A: .Lectins are the specialised proteins that may bind to a specific carbohydrates present on the…
Q: For this statement, answer True or False and explain your answer briefly. In the precipitin test of…
A: Precipitin test is a simple serological technique that shows the precipitin reaction in solution.…
Q: CYCLINs are regulatory proteins active for only portions of the cell cycle. Their transcription is…
A: Cells are the fundamental units of all living organisms. Cells form different tissues in organisms…
Q: Further explain cell maintenance
A: The role of telomeres in cell maintainence. Telomeres shows the ends of all eukaryotic chromosomes.…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A:
Q: Concentration of Oxygen in Water Temperature (°C) Oxygen Concentration in Freshwater (ppm) Oxygen…
A: The earth's surface is covered 71% by water. Life on earth depends on the availability of…
Q: Describe the unique way that auxin can move through a plant.
A: Auxins are a type of plant enzyme that resembles morphogens in some ways. Auxins are important for…
Q: hormonal regulation of metabolism of the exercising skeletal muscle - -insulin -androgens…
A: Answer : The definition of hormonal regulation of the exercising skeletal muscle. Metabolic…
Q: Please help with the following: Simple genetic diseases are expected to be ______________ in the…
A: ANSWER;- b) Rare depending on the severity of the disease. Explain;- Rare human genetic diseases can…
Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…
A:
Q: NK cells express _____. a. receptors to recognize alterations to human cell surfaces induced by…
A: Natural killer (NK) cells are lymphocyte that descend from the very same progenitor as T and B…
Q: Match the pieces of the negative feedback arc that regulated the increase in stroke volume seen…
A: Answer given in step 2. Thank you.
Q: 3. Техt membrane receptors? A. reducing the amount of ligand available to bind the receptor…
A: cell signaling is a process of receiving, processing, and transmitting signals.
Q: from stimulus to effector muscle
A: We know that nervous system will coordinate and control the activities of animals and humans .…
Q: Estimate the flow resistance in a small arteriole (lumen diameter 25 microns; length 0.1 cm) for a…
A: Flow resistance in arteriole is the result of the force that must be overcome to keep blood flowing…
Q: DDT is contaminating your local well water. the concentration in the ground water is 2.7 mg/L. the…
A: DDT: DDT, or dichlorodiphenyltrichloroethane, is a colourless, odourless, and tasteless crystalline…
Q: Sign in Draw Design Layout References Mailings Review View Help Tell me what you want to do nswer:…
A: Polymer are made up of many monomers. The polymerization reaction allows the formation of different…
Q: Draw chromosomes in the following cells to represent the various stages of mitosis and meiosis for…
A: When a mother cell splits into two or even more new cells, this is called cell division. Normally,…
Q: 6. In man, normal color vision vs red-green color blindness is controlled by the allelic gene C…
A: The colorblind trait is encoded by genes present on the X chromosome. It is a kind of recessive…
Q: In a recent influenza epidemic, physicians were utilizing a rapid diagnostic test to determine which…
A: Influenza It is a viral infection caused by influenza virus. This virus infects the respiratory…
Q: 32. Operons are the basic units by which transcriptional regulation occurs in prokaryotes. Using…
A: Genes coding for functionally related proteins are concentrated throughout the DNA of bacteria and…
Q: 3. Explain and elaborate what is the respiratory system and circulatory system. Give its…
A: Respiratory system The respiratory system is crucial to every human being. Without it, we would…
Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…
A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…
Q: organisms such as plants, leaves, flowers, and trees? 2. Are these the result of randomness and…
A: Answer :: 1) Evolutionary adaptation, or simply adaptation, is the process through which organisms…
Q: A. AG for the two reactions is different B. Trypsin is a protein, and elastase is not D. One of the…
A: DNA: DNA is an organic molecule that includes genetic information as well as instructions for…
Q: Name and describe the two forms of energy and provide an example of each.
A: According to science , energy is the quantitative attribute that must be transmitted to a body or…
Q: The epidemic that infected Europe, North Africa, and theMiddle East and killed tens of millions of…
A: Introduction An epidemic is a sudden increase in the number of instances of a disease beyond what…
Q: Which gymnosperm family has fleshy, drupaceous appearing fruits?
A: The plant body is complex, made up of several systems. Each system in the body has a distinct…
Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?
A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…
Q: QUESTION 3 You are a clinical geneticist who is evaluating a newborn female child with a congenital…
A: The female child has two X chromosomes and 44 Autosomes. The number of barr body is determined by…
Q: What is seed dormancy? Why is it good?
A: ANSWER;- Seed dormancy;- Seed dormancy is a transformative adaptation that keeps seeds from…
Q: Supported lipid bilayers (SLBs) are widely used in biophysical research to investigate the effect of…
A: Supported lipid bilayer or SLB is the artificial platform based on solid surface, that can mimic the…
Q: What role do glycocalyces play in the ability of bacteria to survive and cause disease? ( this…
A: The outermost layer of the glycocalyx, followed by a cell wall, and finally the inner plasma…
Q: Head Air sac comection with humerus bone Bronchus Humenus bone Heart 7 8.
A: Lungs are essential parts of the respiratory system. A pair of lungs are formed in such a manner…
Q: NO EXPLANATION NEEDED, ANSWER ONLY. 21. Adults of filarial worms live in: I. blood II. lymphatics…
A: Filarial worms: adult worms live in he lymph system. 21. C- II only.
Q: Galapagos marine iguanas are differentiated by islands. However, the iguanas swim well, suggesting…
A: Answer :: The proportion of alleles (m) of isla tortuga fr isabela. Allele A frequency p=0.2 in next…
Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…
A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating. “…
Q: A niche is loosely defined as an organism's role in its environment, which can include factors such…
A: features California red legged frog north pacific frog habitat usually prefer damp and wet…
Q: This question follows from the last question The D value for a resistant strain of bacterial spores…
A: Time required to ensure a SAL of 10^6.
Q: The O-antigen is part of the bacterium's which is found in the outer membrane of some bacterial cell…
A: O-antigen plays a very important role in microbes and host interaction. It is generally present in…
Q: Which statements explain the primary difference between the structure of a nucleic acid and the…
A: INTRODUCTION DNA : Genetic material made-up of nucleotide. Protein : Macromolecule madeup of amino…
Q: Describe the probable root system of a crop that has been applied with frequent and light
A: Given: Need to describe the probable root system of crop that must be applied Frequently and in…
Q: Briefly describe another technique you can use to study the interaction of Vitamin D3 with lipid…
A: Vitamin D3 with lipid membrane interaction.. Vitamin d3 is very important for our body as it…
Q: You have created a green fluorescent protein (GFP) fusion to a protein that is normally secreted…
A: Yeast strain that is mutated and affecting cisternal maturational model.
Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…
A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG mRNA codon is ..…
Q: Create a food web and Trophic Pyramid for an identified ecosystem. Only drawings Requirements:…
A:
Q: Please summarize how the virus interacts with the cells in the airway and lungs and is related to…
A: SARS CoV 2 enters the body via inhalational route. Its particle size is small enough to reach deeper…
Q: New mutations are removed from the population by means of _____ due to the deleterious consequences…
A: Natural selection is the force which ensures differential contribution of alleles of a gene to the…
Q: Drug-resistant populations of microbes arise when __________________________. Group of answer…
A: Introduction :- Microbes can also pass on genes to one another, including those that make them…
Q: What is genetic counseling? Briefly describe genetic counseling and give an example.
A: Introduction :- People can seek genetic counselling to learn more about how hereditary disorders can…
What explains why some species are polygynous, some polyandrous, and some monogamous? Name the term, describe what it means, and give one example to help explain your answer.
Step by step
Solved in 2 steps
- Many factors influence a species mode of reproduction. Use the descriptions of the following species to predict what system of hermaphroditism they probably display. 1. Individuals rarely disperse once they are sexually mature, and the largest males get the most matings. Females protect the eggs. [Select] 2. Resources are of uniform quality and evenly dispersed, so males are unable to monopolize them. Females are larger than males; Males protect the eggs. [Select] 3. Individuals are solitary, rarely meet others, and have no way of knowing the sex ratio in the population. There is no parental care. [Select] [Select] protogynous hermaphrodite continuous hermaphrodite protoandrous hermaphroditeExplain the cost of sex in ecology?give one species that is classified or exhibit the following: infanticide show a photograph of it with its sexual traits (body stuctures, behavior, etc) and how these traits help their reproduction. explain
- give one species that is classified or exhibit the following: infanticide show a picture of it with its sexual traits (body stuctures, behavior, etc) and how these traits help their reproduction. explain give one specific example please and explainAll of the following scenarios are examples of barriers that distinguish separate species. Which is not a post-zygotic barrier? * Two species of ladybugs live in the same habitat. Although they mate at the same time of year, their genitals are physically incompatible. Two species of fish inhabit the same stream. They are capable of mating and producing healthy offspring. The offspring, however, are infertile. Two species of opossums inhabit the same forest. Although they are capable of mating, no offspring ever survive development. Two species of mice coexist in a forest habitat. They are capable of mating and producing offspring. The offspring, however, are frail and die young.What is the role of group behavior on individual and species' chances to survive and reproduce?
- In seahorses, males incubate and care for offspring. Thus, the males are more likely to be tied up in reproduction at any point in time relative to females. Which sex do you predict will be the choosey sex in this species and why? Males -- because fewer are available to mate Males – because male-male competition is incredibly strong Females – because sperm are cheap to produce Female – because the operational sex ratio is biased in their favor The sperm of chimpanzees have faster swimming speeds than those of gorillas. Based on what you know about sperm competition, what would you predict about differences between these two species in female re-mating frequency and sperm viability? In chimps, females mate only once and sperm are viable for only a day In chimps, females mate multiply and sperm live for a long time In chimps, females mate only one, and sperm live for a long time In chimps, females mate multiply, and sperm live for only a day Which of the following sexual traits is…Which of the following observations or hypotheses is most consistent with the Bateman-Trivers paradigm? sperm are frail and few can actually fertilize an egg males attempt to secure large territories to attract many females male spiders mate only once are sometimes eaten by females O females seek many mates to ensure genetic diversity in their young12 13 14 15 16 17 18 19 20 QUESTION 9 Under what circumstances does a one male polygynous group become a multi-male polygynous group? O 1. When neigborhing polyandric groups threaten the male's masculinity O 2. When females enter Estrus at the same time O 3. When the group's population of females and children gets too large for one male to defend by himself O 4. When primates are put in semi-free ranging environments O 5. When females born in the group move out of the group due to philopatric structures QUESTION 10 True or false: In monogamous groups the males and females may have more than one mating partner O 1. False O2. True Click Save and Submit to save and submit. Click Save All Answers to save all answers. hp f9 f8 f6 10 t7 1- 1O 米 %24 4 & 7 8 6. CO 近 %23
- Which of the following statements best describes the advantage of sexual reproduction in organisms? It reduces genetic variation, which may be useful in the future. It prevents adaptation in a changing environment. It yields offspring with novel combinations of traits. It eliminates the possibility of harmful traits being passed on. tnf: Which of the following statements best describes the functions of villi and microvilli? Villi and microvilli form the inner layer of epithelial tissue in the small intestine and increase the absorption of nutrients from chyme. Villi and microvilli absorb food through the small intestine via smooth muscle contractions called peristalsis. Villi and microvilli increase the surface area of the small intestine, which increases the absorption of nutrients by diffusion. Villi and microvilli increase the surface area of the small intestine, which aids in the absorption of bile salts and vitamin B12.According to Darwin, which of the following would limit an individuals' reproductive success? Question 16 options: They display strong mate selection. They produce few and infrequent offspring. They are more likely to survive environmental changes than others in their species. They have many inheritable traits.The survival and reproduction of young Lazuli buntings (birds) depends on the brightness of their feathers, which range from dull brown to bright blue. Juvenile birds with dull brown feathers are not attacked by adult birds and are able to obtain high quality territories and reproduce more. Juvenile birds with bright blue feathers are more attractive to mates and reproduce more when they become adults. However, birds with intermediate plumage are often attacked by adults and usually fail to reproduce. This is an example of what type of selection? Stabilizing Directional Disruptive Frequency-dependent Artificial